ID: 1034466957

View in Genome Browser
Species Human (GRCh38)
Location 7:151235436-151235458
Sequence GAGCAGGCCCGGTACTGTCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034466948_1034466957 23 Left 1034466948 7:151235390-151235412 CCAAGACCTGTACTTAGGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1034466957 7:151235436-151235458 GAGCAGGCCCGGTACTGTCATGG 0: 1
1: 0
2: 0
3: 7
4: 71
1034466950_1034466957 17 Left 1034466950 7:151235396-151235418 CCTGTACTTAGGCCGGGCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1034466957 7:151235436-151235458 GAGCAGGCCCGGTACTGTCATGG 0: 1
1: 0
2: 0
3: 7
4: 71
1034466953_1034466957 5 Left 1034466953 7:151235408-151235430 CCGGGCAGAGGAGTTCATTGGCG 0: 1
1: 0
2: 1
3: 9
4: 98
Right 1034466957 7:151235436-151235458 GAGCAGGCCCGGTACTGTCATGG 0: 1
1: 0
2: 0
3: 7
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034466957 Original CRISPR GAGCAGGCCCGGTACTGTCA TGG Exonic
900193284 1:1360399-1360421 GAGCAGGCCTGGTAGTGACCAGG + Intronic
901400099 1:9010065-9010087 CAGCGGGCCCGGTTCAGTCAGGG + Intronic
902458662 1:16554536-16554558 GAGCAGTCACTGAACTGTCAGGG - Intergenic
902493495 1:16853380-16853402 GAGCAGTCACTGAACTGTCAGGG + Intronic
903151849 1:21415296-21415318 GAGCAGTCACTGAACTGTCAGGG - Intergenic
905519086 1:38584214-38584236 CAGCAGGGCAGGTACTGTCAGGG - Intergenic
908150798 1:61300045-61300067 GAGCTGGCCAGGTCCTCTCAAGG + Intronic
909321064 1:74286383-74286405 GAGCAGGCCTGGAGCTGTGAGGG - Intronic
910939247 1:92515391-92515413 GAGTAGAACTGGTACTGTCATGG - Intronic
912209989 1:107546736-107546758 CAGCAGGCCAGGTGCAGTCATGG - Intergenic
913606987 1:120475830-120475852 GAGCAGTCACTGAACTGTCAGGG + Intergenic
914209446 1:145564314-145564336 GAGCAGTCACTGAACTGTCAGGG - Intergenic
914268366 1:146056682-146056704 GAGCAGTCACTGAACTGTCAGGG - Intergenic
914368729 1:147004179-147004201 GAGCAGTCACTGAACTGTCAGGG + Intergenic
914584205 1:149046008-149046030 GAGCAGTCACTGAACTGTCAGGG - Intronic
1069808518 10:71141409-71141431 GGGCAGGCCAGGCACTGTCCTGG + Intergenic
1072989445 10:100177360-100177382 GAGCAGGCGTATTACTGTCAAGG - Intronic
1074752287 10:116598190-116598212 GAGCAGGGCGGGTACTTTCCTGG + Intronic
1077146856 11:1050308-1050330 CAGCTGGCCCGGCTCTGTCATGG - Intergenic
1081702627 11:45161630-45161652 GAGCCGTCCCGGGACTCTCAGGG - Intronic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1089494856 11:118902782-118902804 GAGCAGGCGGGGCACTGCCAGGG + Exonic
1097611216 12:61823578-61823600 TAGCAGGCCAGGTCCTGTCCTGG + Intronic
1100239267 12:92694539-92694561 GAGCAGGCCTGGTTCTGTGTTGG + Intergenic
1102907838 12:116690625-116690647 GAGAAGACCCTGTGCTGTCATGG - Intergenic
1106085983 13:26541916-26541938 GAGAAGGCCGGGTACATTCAGGG - Intergenic
1115910744 14:38254760-38254782 GACAAGCCCCAGTACTGTCATGG + Exonic
1122716883 14:103701250-103701272 GAGCTGGCCCGGGACAGCCAGGG + Intronic
1132685031 16:1158657-1158679 GAGCAGGCCGGGCCCTGGCAGGG + Intronic
1132975269 16:2707927-2707949 GACCAAGCCCGGGACAGTCAAGG + Exonic
1134536267 16:15029081-15029103 GAGCAGGCCCAGCACTGGCAGGG - Intronic
1136093737 16:27938848-27938870 GAGCAGCCCAAGTACTGGCAAGG + Intronic
1139859800 16:70011704-70011726 GAGCAGGCCCAGCACTGGCAGGG + Intergenic
1142904560 17:3033455-3033477 CAGCAGGGCTGGGACTGTCAGGG - Exonic
1146160410 17:30556528-30556550 GAGCATACCCGGTATTGTCTGGG - Intergenic
1146957640 17:36946137-36946159 GAGGAGGCCTGGAAATGTCAGGG + Intergenic
1150829921 17:68510568-68510590 GAGCAGGCCCGGTCATGTTATGG - Intergenic
1158390082 18:57037877-57037899 GAACAGCCCCTGTCCTGTCAGGG - Intergenic
1160833994 19:1116202-1116224 GCCCAGGCCCGGTCCTGTCCGGG - Intronic
1166460631 19:42984938-42984960 GAGCATGCCCTGTACTCTCCAGG - Intronic
1166666055 19:44681054-44681076 GGGCAGGCCTGGGACTGTCGTGG + Intronic
1166963798 19:46515548-46515570 GGGCAGGTCCAGTATTGTCATGG + Intronic
1202708877 1_KI270714v1_random:5574-5596 GAGCAGTCACTGAACTGTCAGGG + Intergenic
926059572 2:9796654-9796676 GGCCAGGCCCGGTTCTGCCAGGG + Intergenic
935716816 2:105946590-105946612 GAGCAGGCGCGCTAGAGTCAAGG - Intergenic
1175415822 20:58800366-58800388 GAACAGGGCTGGTACTGGCACGG + Intergenic
1177560612 21:22746493-22746515 GAGGAGGCCGAGTTCTGTCAGGG + Intergenic
1181060261 22:20278957-20278979 CAGCTGGCCCGGTCCTGGCAGGG - Intronic
950487379 3:13281638-13281660 CAGGAGTCCCAGTACTGTCATGG - Intergenic
961203435 3:125062340-125062362 GAGCATGCCCAGCGCTGTCACGG + Intergenic
961484462 3:127207335-127207357 GAGCAGGCCTGCCACTGTCCAGG + Intergenic
963172013 3:142260952-142260974 GGGCATGCCCGGATCTGTCATGG + Intergenic
968548211 4:1209351-1209373 GAGCAGGACACGTCCTGTCATGG + Intergenic
976269200 4:83213809-83213831 GAGCATGCCTGGCACTTTCAAGG + Intergenic
985622646 5:963513-963535 GGCCAGGCCCGGGGCTGTCACGG - Intergenic
989734420 5:44686820-44686842 GAGGAAGCCTGCTACTGTCATGG + Intergenic
990446749 5:55900187-55900209 GAGCAGTCCCTGTGCTCTCAAGG + Intronic
992181191 5:74200063-74200085 GAGCAGAACCAGCACTGTCAGGG + Intergenic
997319246 5:132963877-132963899 GTGCAGGCCCTGTACTGCCGTGG - Intergenic
1003421654 6:5963709-5963731 GAGTAGGCCTGGGATTGTCAAGG + Intergenic
1003429303 6:6024355-6024377 GAGCAGGACTGGTGCTGTCCAGG + Intergenic
1006743108 6:36323268-36323290 GAGCAGGCCTGGTGTTGCCATGG - Intronic
1013403034 6:109817191-109817213 GAGCAGACCCAGTACTGTGCAGG + Intronic
1023829169 7:44029140-44029162 GAGCAGGCTTGGGCCTGTCATGG - Intergenic
1029739471 7:102483397-102483419 GAGCAGGCTTGGGCCTGTCATGG - Exonic
1029757472 7:102582576-102582598 GAGCAGGCTTGGGCCTGTCATGG - Exonic
1029775412 7:102681637-102681659 GAGCAGGCTTGGGCCTGTCATGG - Intergenic
1034466957 7:151235436-151235458 GAGCAGGCCCGGTACTGTCATGG + Exonic
1035682895 8:1501466-1501488 GAGCATGCCCGGTTCTGTCCGGG - Intronic
1035724904 8:1818218-1818240 TAGCAGGCTCAGTACGGTCAGGG + Intergenic
1040291953 8:46130056-46130078 GAGCAGGCCCGGGACAGTCCTGG + Intergenic
1040582503 8:48708885-48708907 GAGCTGCCCCGGGACTGGCAGGG + Intergenic
1049083625 8:140461040-140461062 AAGCAGTCCCCGTACTGTCTAGG + Intergenic
1057197040 9:93121033-93121055 GACCAGGCCCTGGACTCTCAGGG - Intergenic
1061215205 9:129217765-129217787 CAGGAGGCCGGGTGCTGTCAGGG + Intergenic
1062394102 9:136345793-136345815 GAGCAGGCCCCGAACTGTGTGGG + Intronic
1187503833 X:19863014-19863036 GAAGAGGCCCAGGACTGTCAGGG + Intronic
1192050596 X:67720710-67720732 GAGCAGGCCTGGTATTGTCTGGG - Intronic
1199944242 X:152652754-152652776 GAGCAGGCCCGGCACAGCTATGG + Exonic