ID: 1034467416

View in Genome Browser
Species Human (GRCh38)
Location 7:151238254-151238276
Sequence CACCACAGAGATCACCCCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034467409_1034467416 11 Left 1034467409 7:151238220-151238242 CCAGTCCATTTCCAGGAGTTCAA 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1034467416 7:151238254-151238276 CACCACAGAGATCACCCCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 188
1034467411_1034467416 0 Left 1034467411 7:151238231-151238253 CCAGGAGTTCAATCCTGCCCTGT 0: 1
1: 0
2: 1
3: 54
4: 988
Right 1034467416 7:151238254-151238276 CACCACAGAGATCACCCCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 188
1034467410_1034467416 6 Left 1034467410 7:151238225-151238247 CCATTTCCAGGAGTTCAATCCTG 0: 1
1: 0
2: 1
3: 17
4: 212
Right 1034467416 7:151238254-151238276 CACCACAGAGATCACCCCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 188
1034467407_1034467416 19 Left 1034467407 7:151238212-151238234 CCTTCTTTCCAGTCCATTTCCAG 0: 1
1: 0
2: 1
3: 36
4: 335
Right 1034467416 7:151238254-151238276 CACCACAGAGATCACCCCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034467416 Original CRISPR CACCACAGAGATCACCCCCA GGG Exonic