ID: 1034468510

View in Genome Browser
Species Human (GRCh38)
Location 7:151243682-151243704
Sequence CAGTGCCAAGAGGAGGAAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 594
Summary {0: 1, 1: 0, 2: 3, 3: 67, 4: 523}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034468510_1034468517 24 Left 1034468510 7:151243682-151243704 CCATCTTCCTCCTCTTGGCACTG 0: 1
1: 0
2: 3
3: 67
4: 523
Right 1034468517 7:151243729-151243751 GTTACCATGGCGACAGATCTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1034468510_1034468516 23 Left 1034468510 7:151243682-151243704 CCATCTTCCTCCTCTTGGCACTG 0: 1
1: 0
2: 3
3: 67
4: 523
Right 1034468516 7:151243728-151243750 GGTTACCATGGCGACAGATCTGG 0: 1
1: 0
2: 1
3: 4
4: 63
1034468510_1034468513 2 Left 1034468510 7:151243682-151243704 CCATCTTCCTCCTCTTGGCACTG 0: 1
1: 0
2: 3
3: 67
4: 523
Right 1034468513 7:151243707-151243729 CATTTTTTAAAGAAAAAACCAGG 0: 1
1: 2
2: 11
3: 142
4: 1251
1034468510_1034468514 11 Left 1034468510 7:151243682-151243704 CCATCTTCCTCCTCTTGGCACTG 0: 1
1: 0
2: 3
3: 67
4: 523
Right 1034468514 7:151243716-151243738 AAGAAAAAACCAGGTTACCATGG 0: 1
1: 0
2: 2
3: 31
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034468510 Original CRISPR CAGTGCCAAGAGGAGGAAGA TGG (reversed) Exonic
900032047 1:379284-379306 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
900052596 1:607470-607492 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
900124393 1:1063036-1063058 CAGTGCCCAGAGGAGGAATCTGG - Intergenic
900474557 1:2869996-2870018 CAGAGGGAAGAGGAGGATGAAGG + Intergenic
900803970 1:4755415-4755437 CAGAGCCAGCAGGAGGGAGACGG - Intronic
901817039 1:11800286-11800308 CAGTGGGAAGAGGAGGAGGGAGG - Exonic
901826911 1:11868071-11868093 CAGTATCAAGAGGAGGGAGAAGG - Intergenic
902057316 1:13612317-13612339 CAGTGCCATTGGGAGGGAGATGG + Intronic
902397745 1:16141704-16141726 CTATGCCAAGAGGAGGAAGTGGG + Intronic
902806366 1:18863635-18863657 CAGTGCAAAGAGGGCAAAGAGGG - Intronic
902847577 1:19123973-19123995 CACTGGCAGCAGGAGGAAGAAGG + Intronic
902993147 1:20203709-20203731 CAGTAGAAAGAAGAGGAAGATGG + Intergenic
903737926 1:25542182-25542204 CTGTGCCAAAAGGAGCCAGAGGG - Intergenic
904138011 1:28329023-28329045 AAGTGAGAAGAGGAGGAAGTTGG + Exonic
904222861 1:28987480-28987502 CAGCACCAACAGAAGGAAGAGGG + Exonic
904272050 1:29356545-29356567 CAGAGCTAAGAGAAGGAAGGAGG + Intergenic
904864752 1:33569577-33569599 CAGCCCCAAGAGGAGGGACATGG + Intronic
904893679 1:33798441-33798463 GAGTGCAAAGAGGAGAGAGATGG + Intronic
904983817 1:34528140-34528162 CGGGGCCCAGAGGAGGAAGTAGG + Intergenic
905791009 1:40789533-40789555 GAGTGCAAGGAGGAGGAGGAAGG - Intronic
906309007 1:44739709-44739731 CGGTGCCAAGCGTAGGAAGATGG + Intergenic
906661480 1:47585921-47585943 CAGCCAGAAGAGGAGGAAGAGGG + Intergenic
906749347 1:48245201-48245223 AACTGCCAAGAGAAGGAGGAAGG + Intronic
906812675 1:48845071-48845093 CAGTCCCAAGGAGAGGCAGAAGG + Intronic
906911860 1:49961033-49961055 CTGTGCCATGCTGAGGAAGATGG + Intronic
907319298 1:53592765-53592787 CTGTGCCAAGGGGAGGCAGGAGG - Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
909415956 1:75405733-75405755 AAGTGCCCACAGGAGAAAGAAGG + Intronic
909686539 1:78355188-78355210 GAGGGAGAAGAGGAGGAAGAGGG - Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
911634772 1:100222744-100222766 CAGTGAAAGGAGGAGAAAGAGGG - Intronic
914914865 1:151813426-151813448 CAGAGCCAAGTGGAGGGAGGTGG - Intronic
914950630 1:152110653-152110675 CAGCTCCAGGAGGAGGAGGACGG - Exonic
915635983 1:157186882-157186904 CATTGCCAAGAGGAGACAGAGGG - Intergenic
915648090 1:157288176-157288198 CATTGCCAAGAGGAGACAGAGGG + Intergenic
915864223 1:159481112-159481134 CAAAGTCAAAAGGAGGAAGACGG + Intergenic
917002466 1:170374943-170374965 CAGTGCCAAGAGGAAATACAGGG - Intergenic
917165684 1:172110124-172110146 CAGGGGCAAGAGAAGGAACAGGG - Intronic
918092301 1:181308114-181308136 CAGTCCCAGGAGGAGCAGGAGGG - Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919742794 1:200990837-200990859 CAGGGCCAGGGTGAGGAAGAGGG - Intronic
919887372 1:201944688-201944710 CTTTGCCAAGAAGAGGGAGAAGG - Intronic
920044944 1:203127104-203127126 CTGTGCTATGAAGAGGAAGAAGG + Exonic
921628980 1:217411053-217411075 CAGAGGCAAAAGGAGAAAGAGGG - Intergenic
922567599 1:226611053-226611075 CATTCCCAAGAGGACCAAGATGG + Intergenic
924952193 1:248895372-248895394 AAGGACAAAGAGGAGGAAGAAGG + Intergenic
1063371517 10:5525614-5525636 CAGTGCCCAGGGGAGGCAGGGGG - Exonic
1064931903 10:20637826-20637848 CAGAGCCAATAGGAGGTATATGG + Intergenic
1065694287 10:28365661-28365683 AAGTGAAAAAAGGAGGAAGAAGG + Intergenic
1068971079 10:62959135-62959157 AAGTGCCAGGAGAAGGATGATGG - Intergenic
1069230809 10:66006578-66006600 CACTGCCAACAGGAAAAAGAGGG - Intronic
1069870030 10:71527443-71527465 CAGGGCCCAGAGGAGGAGGCTGG - Intronic
1069940150 10:71949677-71949699 AAATGCTAAAAGGAGGAAGAGGG + Intergenic
1070336977 10:75464504-75464526 CTTTGCCAAGAGGAGCAATAAGG + Intronic
1070415882 10:76188831-76188853 CAAACCCAAGAGGAGGAGGATGG + Intronic
1070483198 10:76905367-76905389 CAGTGGCATTAGGAGGAAGCTGG + Intronic
1070525414 10:77292141-77292163 CCCTGCCCAGAGGAGGATGAAGG - Intronic
1070550786 10:77489024-77489046 CTCTGCCTAGAGGGGGAAGATGG - Intronic
1070697751 10:78575271-78575293 AGGTGCCAGGAGGAGGTAGAAGG + Intergenic
1071289888 10:84181071-84181093 CCGTGCAAAGAGGAGGGAGAGGG + Intronic
1071289900 10:84181123-84181145 CCGTGCAAAGAGGAGGGAGAGGG + Intronic
1071289912 10:84181175-84181197 CCGTGCAAAGAGGAGGGAGAGGG + Intronic
1073454550 10:103628673-103628695 CAGAGCCTAGGGGAGGGAGATGG - Intronic
1074393919 10:113081245-113081267 CGGGGCCAAGAGGGAGAAGAGGG - Intronic
1074533223 10:114311001-114311023 CATTGACCAGTGGAGGAAGAGGG + Intronic
1075462889 10:122630603-122630625 CAGTGCCAAGAGAAAGAGAATGG - Intronic
1075663935 10:124217557-124217579 CAATGCTAACAAGAGGAAGAAGG + Intergenic
1076021408 10:127076817-127076839 AAATGCCACCAGGAGGAAGAAGG - Intronic
1076370410 10:129949402-129949424 CAGTGCCAAGAAGACTAAGCCGG + Intronic
1076412623 10:130262723-130262745 CAGTGAGAGGAGGAGGCAGAGGG - Intergenic
1076412846 10:130264164-130264186 CAGTGAGAGGAGGAGGCAGAGGG - Intergenic
1076498528 10:130915751-130915773 GAGTTCCAAGAGAAGGAAGGAGG + Intergenic
1076642823 10:131930400-131930422 AAAAGCCAAGAGAAGGAAGATGG - Intronic
1076724058 10:132405181-132405203 CACCGCCAGGAGGAGCAAGAGGG + Exonic
1076838417 10:133032730-133032752 CATTCCCATGAGGAGGGAGAAGG - Intergenic
1077010468 11:377047-377069 GAGGGCGAAGAGGAGGAGGAAGG + Exonic
1077407972 11:2391109-2391131 CAAGGCCAGGAGGAGGAGGAGGG + Intronic
1077611513 11:3645788-3645810 CAGAGCCCAGAGGAGTCAGAGGG + Intronic
1078401220 11:11029003-11029025 CAGGGCCAAGAGGAGATAGCAGG + Intergenic
1078633971 11:13031594-13031616 CAATGCCAAGAGGAGGGTGAGGG - Intergenic
1078732187 11:13984932-13984954 AAGCTCTAAGAGGAGGAAGAAGG - Intronic
1079005461 11:16788746-16788768 CAGAGAGGAGAGGAGGAAGATGG - Exonic
1079043573 11:17080245-17080267 CAGTGCCAACAGCAAGAGGAAGG - Intronic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1079986974 11:27209885-27209907 GTGTGTAAAGAGGAGGAAGATGG + Intergenic
1080189321 11:29525696-29525718 CAGTCCCAAGTGGAGCAAGCAGG - Intergenic
1080384448 11:31802881-31802903 CAGAGTGAAGAGGAAGAAGAGGG + Intronic
1080685938 11:34514777-34514799 CAGTGGCAAAAGGAGGAAGTGGG + Intergenic
1080874699 11:36265131-36265153 CAGTGACAGGATGAGGAAGAAGG - Intergenic
1081567250 11:44267583-44267605 AAGGGCCAAGTGGAGGAAGCGGG - Exonic
1081622651 11:44628135-44628157 CAGTGCCTGGTGGTGGAAGATGG - Intergenic
1081690554 11:45074972-45074994 CATTGCCAATATGAGGAAGGTGG - Intergenic
1082636683 11:55603674-55603696 CAGTGCCAAAGGGAAGAAAAAGG - Exonic
1082798686 11:57397563-57397585 CTATGGTAAGAGGAGGAAGAGGG - Intronic
1083429965 11:62609169-62609191 CAAGGGCAGGAGGAGGAAGAGGG + Intronic
1083691988 11:64415023-64415045 CCGGCCCATGAGGAGGAAGATGG + Intergenic
1083764015 11:64833575-64833597 CAGTGCCCAGAGGGGCAAGCAGG - Intronic
1084489979 11:69472960-69472982 CTGTGCCCAGAGGAAGAACAAGG + Intergenic
1084873815 11:72116044-72116066 CAGAGCCCAGAGGCTGAAGATGG + Intronic
1084912734 11:72404265-72404287 CAGTGCCAAGAAAGGGAGGAGGG + Intronic
1084978845 11:72817811-72817833 AAGTGGCAGGAGGAGGAGGAGGG + Exonic
1086131917 11:83409956-83409978 AAGAGCCCAGAGGAGGAAGCTGG + Intergenic
1086359371 11:86041364-86041386 TAGTGGCAGGAGGAGGAATATGG - Intronic
1088843184 11:113643776-113643798 AAATGCAGAGAGGAGGAAGAAGG - Intergenic
1089309710 11:117549738-117549760 CAGTTCTAAGAAGAGGAAAATGG - Intronic
1090639307 11:128716891-128716913 CAGTGCAGGGAGGAGGAAGAAGG + Intronic
1090652487 11:128819561-128819583 CAGTGGGAGGGGGAGGAAGAGGG + Intergenic
1090672293 11:128957206-128957228 AGGTGCCAAGAGGAGCGAGAGGG + Intergenic
1090848493 11:130549919-130549941 CAAAGCCAAGAGAAGAAAGAGGG - Intergenic
1091678619 12:2510228-2510250 CAGTCCCCAGAGCAGGAACATGG + Intronic
1093247752 12:16761346-16761368 CAGGGCCATGGGGAGAAAGAAGG - Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093650086 12:21633386-21633408 CAGAGCCAAGAGCTGGAAGAAGG - Intergenic
1094056130 12:26271545-26271567 GAGGACCAGGAGGAGGAAGACGG + Intronic
1094208911 12:27869849-27869871 CAGTGCCAGCAGGAGGATGGCGG + Intergenic
1096260425 12:50086618-50086640 CAGTGCAAAGAAAAAGAAGATGG + Exonic
1096552868 12:52385096-52385118 CAATGCCCAGAGGGTGAAGAAGG - Exonic
1096596435 12:52698846-52698868 TGGTGCCCAGAGGAGGAAGCAGG - Intronic
1097845735 12:64363528-64363550 CTTTGCGAGGAGGAGGAAGAGGG + Intronic
1097996785 12:65896547-65896569 CAGGGAGAAGAGGAGGAAGAAGG - Intronic
1099337462 12:81381525-81381547 CAGGGCCAAGAGAATGAAGATGG + Intronic
1100067668 12:90669668-90669690 CAGTGAAAAGAGGAAGAAGAGGG - Intergenic
1100990166 12:100243487-100243509 TAGTGCCAAGGGTAGGAAGTTGG - Intronic
1101580575 12:106037989-106038011 AGGTGCCAAGAGGAAGAAAAAGG - Intergenic
1101649058 12:106658515-106658537 CTGAGCCACAAGGAGGAAGAAGG - Intronic
1101881008 12:108625766-108625788 CAGTGCCAAGGAGAGCATGAGGG - Intronic
1101969377 12:109302116-109302138 AAATGCCAAGAGGACAAAGATGG + Intronic
1102840348 12:116113694-116113716 CAGTGAGTGGAGGAGGAAGAGGG + Intronic
1103401127 12:120643430-120643452 CAGAACCAAGAGAAGGCAGATGG + Intronic
1103847214 12:123909818-123909840 CACTGACAAGAGGAGAAAGGGGG - Intronic
1104379736 12:128296713-128296735 GAGTGTCATGAGGAAGAAGATGG + Intronic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104578644 12:129992094-129992116 CCTTGGCCAGAGGAGGAAGAGGG - Intergenic
1104715436 12:131013116-131013138 CAGGGCCAGGAGGAGGGTGAGGG - Intronic
1105468631 13:20671380-20671402 AAGTGCCACGAGAAGGAGGATGG + Intronic
1106490412 13:30216485-30216507 CAGTGCCAAAAGCAGCAAGCAGG + Intronic
1106559762 13:30838130-30838152 CAGTGACAAGAGTGGAAAGAAGG + Intergenic
1106816649 13:33415418-33415440 CAGTGGCAGTAGGAGTAAGAGGG + Intergenic
1107347990 13:39483698-39483720 CAATGCAGAGAGGAAGAAGATGG + Intronic
1107662669 13:42655569-42655591 AAGTGGCATGAGGTGGAAGATGG - Intergenic
1107885822 13:44873439-44873461 CAGGGCCAAGGGGAAGAAGGGGG - Intergenic
1107890050 13:44906091-44906113 CACTGCTAAGGGGAGGAAGAAGG + Intergenic
1108315840 13:49236500-49236522 AAGTGCCTTGAGGAAGAAGAGGG - Intergenic
1108372631 13:49785889-49785911 CAGAGCCAAGAGGCAGAACATGG + Intronic
1109298697 13:60567513-60567535 CTTTGCAAATAGGAGGAAGAAGG + Exonic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1110792054 13:79597284-79597306 CTTTGCCAAAAGCAGGAAGAGGG + Intergenic
1110918199 13:81049304-81049326 CAGTTACAAGAGGAGCAAGTTGG + Intergenic
1112104748 13:96228858-96228880 CAGCCCCAGAAGGAGGAAGAGGG + Intronic
1112667542 13:101593748-101593770 CAGAGACGGGAGGAGGAAGATGG + Intronic
1113084686 13:106556030-106556052 CAGTGCAGATAGGAAGAAGAGGG - Intronic
1113129822 13:107023484-107023506 CAAGGGCAAGAGGAGGATGAAGG - Intergenic
1113961507 13:114128753-114128775 CTGAGCCCAGAGGAGAAAGAAGG + Intronic
1114539844 14:23446723-23446745 CAGGGCCAGGAAGACGAAGAGGG - Intergenic
1114601003 14:23955235-23955257 CAGAGCCAGGAGGTGGAAAACGG + Intronic
1114610671 14:24037943-24037965 CAGAGCCAGGAGGTGGAAAAGGG + Intergenic
1115028124 14:28766414-28766436 CAGTACAATGAGGAGGAAGCCGG + Intergenic
1116242927 14:42369859-42369881 AGATGGCAAGAGGAGGAAGAAGG + Intergenic
1116692306 14:48124640-48124662 CAGTAGAAATAGGAGGAAGAGGG - Intergenic
1117667319 14:58070200-58070222 CAGCTCAAAGAGGAGGAAGAAGG + Intronic
1118367063 14:65104960-65104982 AAGAGCTCAGAGGAGGAAGAAGG + Intergenic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119517127 14:75257200-75257222 CAGTTCCAAGCAGAGGAAGAAGG - Intronic
1119575273 14:75715295-75715317 CAGGGCCCACATGAGGAAGATGG - Intronic
1119604975 14:76007813-76007835 TAGACCCAAGAAGAGGAAGAAGG + Intronic
1120718614 14:87866855-87866877 CATTGTCAGGAGGAGAAAGAAGG + Intronic
1120809752 14:88792112-88792134 GAGTCCCTAGACGAGGAAGAGGG + Intronic
1120913673 14:89690743-89690765 AAGGGCAAAGAGGAGGAAGCAGG + Intergenic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1121755545 14:96399377-96399399 CAGTGGCAAGAAGAGAGAGAAGG - Intronic
1121930224 14:97965450-97965472 CATTGACAACAGGAGGGAGAGGG + Intronic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1123834092 15:24170112-24170134 CAGTGGCAAGAAGAGAAAGGAGG + Intergenic
1123902674 15:24892372-24892394 AAGTGGCAAGAGTAGGAAGGAGG + Intronic
1124047252 15:26161707-26161729 CAGTACCAGCAGGAGGAAGGTGG - Intergenic
1124371014 15:29104662-29104684 CAGTGCCCACTGGAGGCAGAGGG - Intronic
1124886826 15:33695097-33695119 CAGTGCCAAGGGGACAATGAAGG - Intronic
1126441710 15:48696885-48696907 CAGTTGCAAGATGAGGAAGCTGG + Intergenic
1127810669 15:62562476-62562498 CAGAGCCAAGAGGGAGCAGAGGG - Intronic
1127973902 15:63983335-63983357 CAGTTTCAGGAGGAGGAAGCGGG + Intronic
1128779730 15:70351494-70351516 CAGTGGCAAGAGGAGAAGCAGGG - Intergenic
1129084530 15:73074773-73074795 CAGTGTCAAGGAGAGGAAGGAGG - Intronic
1129450500 15:75648550-75648572 CAGGAGCAAGAGGAGGAAGGAGG + Exonic
1129519992 15:76179519-76179541 AAGTGCCATGAGTAGGAAAAAGG - Intronic
1130993203 15:88889047-88889069 GAGAGGGAAGAGGAGGAAGACGG + Intronic
1131416340 15:92262356-92262378 AAATGCCAAGAGGAGGAAATGGG - Intergenic
1133067035 16:3215639-3215661 GAGTCCCAAGAGGAGGAACTCGG - Intergenic
1134031907 16:10998806-10998828 CAGTGGCGAGAGGAGGGACAGGG + Intronic
1134340859 16:13344439-13344461 AAGGGCATAGAGGAGGAAGAAGG - Intergenic
1135851454 16:25967712-25967734 AAGTGAGAAGAGAAGGAAGAGGG + Intronic
1135911009 16:26560729-26560751 CAGAGCCTAGATGAGGAACAGGG + Intergenic
1136533128 16:30883138-30883160 CAGTTCCCAGACCAGGAAGAGGG + Intronic
1137433469 16:48436745-48436767 AATTGCCGAGAGGAGGGAGAAGG + Intronic
1138413584 16:56858481-56858503 CACAGCCCAGAGGAGGAAGCCGG + Intergenic
1138938410 16:61759432-61759454 CAGTAGTAGGAGGAGGAAGAGGG + Intronic
1139357097 16:66372890-66372912 CAGTTCCAAATGGAGGAGGATGG - Intronic
1140416692 16:74778682-74778704 CAGTCCGAAGAGAAGGGAGAGGG - Intergenic
1140819910 16:78653560-78653582 CAGTGTCCAGAGGAAGCAGAAGG - Intronic
1141636610 16:85317330-85317352 GAGAGCCAAGAGGAGAAGGAGGG - Intergenic
1141762611 16:86038676-86038698 CTGTGCCATGGGGAGGAGGAAGG + Intergenic
1142153448 16:88522716-88522738 CAGGGCCCAGAGGAGGGACAGGG + Intronic
1142250520 16:88989787-88989809 TAGGGCCAAGAGTGGGAAGAGGG - Intergenic
1142693527 17:1621075-1621097 GAGTGCCAAGAACAGGAACAGGG + Intronic
1143447061 17:7015771-7015793 CAGTGCGAAGTGGACGGAGACGG + Exonic
1143881786 17:10035500-10035522 CAGTGCCAGGGGAAGGGAGATGG - Intronic
1144782376 17:17814550-17814572 CAGTGCCCAGGGGATGAGGAAGG + Intronic
1145059207 17:19721543-19721565 CACTGCCAAGTGCTGGAAGATGG + Intergenic
1145104479 17:20103751-20103773 CAGTGCCAGGAGGAAGTGGACGG - Intronic
1145773479 17:27510042-27510064 AAGTGCCAAGAGGAGGGACAAGG - Intronic
1145798608 17:27669772-27669794 CAGGGCCAAGAGGAGGAAGCAGG + Intergenic
1146620285 17:34391796-34391818 CAGGGGCAAGATGAGGAAGAGGG + Intergenic
1146692059 17:34883438-34883460 AAGTTCCTAGAGGAGGAAGGGGG - Intergenic
1146696106 17:34910033-34910055 CACTGCCAACAGCAGCAAGAAGG + Intergenic
1146926789 17:36751032-36751054 CGGTGACAGGAGGAGGAAGGAGG + Intergenic
1146941210 17:36845579-36845601 CAGTGCTGAGAGGAGGAAGGTGG + Intergenic
1147133655 17:38423016-38423038 CAGTGACTAGGGGAGGAAGAAGG - Intergenic
1147803635 17:43113241-43113263 AAGGTCCAAGAGGAGGCAGAAGG - Intronic
1147850016 17:43435188-43435210 CAGTGTCAAGGGGAGGTGGATGG + Intergenic
1147899538 17:43774982-43775004 CAGCCCCAGGGGGAGGAAGATGG + Intronic
1148546382 17:48522319-48522341 CAGAGCCAACAGGAGGAGGCTGG + Intergenic
1148992399 17:51677720-51677742 TAGAGCCAAGAGGAGACAGAGGG - Intronic
1148999170 17:51739478-51739500 CAGAGTCAAGTGGAGGAGGATGG + Intronic
1149027510 17:52045531-52045553 CAGAGCCAAGAGGAGGGCAATGG + Intronic
1149496751 17:57123238-57123260 CAGACCCAAGAGGTAGAAGATGG + Intergenic
1149520436 17:57314491-57314513 CAGTGGCAAGAGATGGAAAAGGG + Intronic
1149968267 17:61190036-61190058 CAGTGCCAACAGGAGTCATAGGG + Intronic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1150437465 17:65165115-65165137 CAGAGCAGACAGGAGGAAGAAGG - Intronic
1151575152 17:74949443-74949465 AAGTGCCAAGGTGGGGAAGATGG + Exonic
1152161537 17:78671394-78671416 CAGAGCCAAGAGGAGAGAGGAGG + Intergenic
1152558007 17:81064138-81064160 GAATGAGAAGAGGAGGAAGAAGG - Intronic
1152639561 17:81443979-81444001 CAGAGCCACGTGGAGAAAGAGGG + Intronic
1152829154 17:82486531-82486553 CACTGACAAGAGGAGGGTGAGGG + Intronic
1152913208 17:83017193-83017215 CAGTGGCGGGAGGAGGAAGGGGG + Intronic
1152947607 17:83206430-83206452 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1153170725 18:2312829-2312851 AAGTGACAAGACAAGGAAGAGGG - Intergenic
1153612302 18:6898879-6898901 CAGGGGCAAAAGGGGGAAGAGGG + Intronic
1154230446 18:12551919-12551941 CACTGCCAGGAGGTGGAGGAGGG - Intronic
1154343206 18:13521598-13521620 GAGTGGCGTGAGGAGGAAGAAGG + Intronic
1154503391 18:15007878-15007900 AAGTGCCAAGAGGAGAAAAAAGG - Intergenic
1156220079 18:35042023-35042045 CAGTGCCAAAAGGCAGAAAACGG + Intronic
1156505228 18:37586491-37586513 GAGTGCCATGAGGAAGAAGCTGG - Intergenic
1156547881 18:37983881-37983903 CAGAGCTCACAGGAGGAAGAAGG - Intergenic
1156791755 18:40984096-40984118 CAGGGGGAGGAGGAGGAAGAGGG - Intergenic
1157096130 18:44686998-44687020 AAGTGCCAAAATGAGCAAGATGG - Intronic
1157218164 18:45802587-45802609 CAGTGCCCAGAGAAGGGAGGAGG + Intergenic
1157893782 18:51444335-51444357 CACTGCTAAGTGGAAGAAGAAGG + Intergenic
1158565012 18:58547452-58547474 TAATGCCTAGAGGAGGGAGAAGG - Intronic
1158622178 18:59042403-59042425 CAGTGCTAAGAGGAGGAAGCAGG - Intergenic
1159796092 18:72846153-72846175 CAGAGCCAAGAGGAGCAAGCAGG + Intronic
1160303165 18:77704802-77704824 CAGGGCCACGGGGAGGAGGACGG + Intergenic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1161689805 19:5725072-5725094 CAACGCCAAGAGGAAGAAGTGGG + Intronic
1162044690 19:7990801-7990823 TAGAGGGAAGAGGAGGAAGAGGG + Intronic
1162556955 19:11392984-11393006 CTGTGACAGGAAGAGGAAGAAGG + Intronic
1163384280 19:16989803-16989825 GAGTGCCAAGAGCAGAAAGGGGG + Intronic
1163527388 19:17830156-17830178 CAGTTCCAAGAGGCGGCAGAGGG + Exonic
1165298587 19:34950449-34950471 CAGTGCCATGAGAAGAAATAAGG + Intergenic
1165730792 19:38143370-38143392 CACTGCAAGGAGGAGGAGGAAGG - Intronic
1166048678 19:40244958-40244980 CAGTGTCAAAATGTGGAAGAGGG - Intronic
1166293350 19:41877345-41877367 CAGCAGGAAGAGGAGGAAGATGG - Exonic
1166331703 19:42081485-42081507 CAGTGCTAAGAGGTGGAAGGTGG - Exonic
1166342870 19:42149305-42149327 CACTGCCAAGAGAAAGAAGAGGG + Intronic
1166803152 19:45470216-45470238 CAGAGGCAAGGGGAGGGAGAAGG - Intronic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167688009 19:50968665-50968687 CAGAGCCAAGCGGAGGACGCAGG + Exonic
1167967161 19:53157493-53157515 CAGGTGCAAGCGGAGGAAGAAGG - Intronic
1168000471 19:53441807-53441829 CAATGCCGAGTGGAGGAAGGAGG + Intronic
1168146256 19:54421259-54421281 CAGTGCTGAGCGGAGGAGGAGGG - Exonic
1168382419 19:55935134-55935156 CACAGCTAAGAGGAGGCAGACGG - Intergenic
1168471524 19:56644046-56644068 CAGTGAATGGAGGAGGAAGAAGG - Intronic
1168695403 19:58401245-58401267 CCGGGGCAAGAGGAGGGAGAAGG - Intergenic
925864983 2:8219700-8219722 CCGTGCCAGGAGGAGGGACATGG - Intergenic
926309187 2:11662202-11662224 TAGTGCCAAGGGGAGCACGAAGG + Exonic
926702007 2:15810091-15810113 CTGAGCCACGAGGAGCAAGAGGG - Intergenic
928373073 2:30755173-30755195 CAGAACTGAGAGGAGGAAGAGGG - Intronic
929588569 2:43131075-43131097 CAGTGCCGAGAAGGAGAAGACGG + Intergenic
930179715 2:48341682-48341704 CTGTGCCAAGAGGAAGAACATGG + Intronic
931055039 2:58460325-58460347 CATTGAGAAGAGGAAGAAGATGG - Intergenic
931096431 2:58945902-58945924 CAGTGCCAGGAGGCCAAAGAGGG - Intergenic
931306403 2:61033649-61033671 GAGTGTCAGGAGGAGGAACAGGG + Intronic
931793834 2:65690552-65690574 TAGTGCAGAGAGGAGAAAGAAGG - Intergenic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
932097681 2:68866101-68866123 CAGTGACAAGGAGAGGAAGGAGG - Exonic
932452756 2:71825414-71825436 AAGTGCAAACAGGAGAAAGAAGG + Intergenic
932693208 2:73931169-73931191 AATTCCCAAGAGGAAGAAGAGGG + Intronic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
932893104 2:75612882-75612904 AAGGGACAAAAGGAGGAAGATGG + Intergenic
933161119 2:79026213-79026235 CAGAGCCAAGAAAAGGAGGAAGG + Intronic
933242359 2:79936451-79936473 AAGAGCCAAGAGGAGGAAAAGGG - Intronic
933811091 2:86033192-86033214 CAGTGACAAAAAGGGGAAGAGGG - Intronic
933951908 2:87338348-87338370 CAGTGCAGAGAGGAAGAAGCAGG + Intergenic
934134150 2:88979124-88979146 CAGTGCAGAGAGGAAGAAGCAGG - Intergenic
934139087 2:89027824-89027846 CAGTGCAGAGAGGAAGAAGCAGG - Intergenic
934145158 2:89085831-89085853 CAGTGCAGAGAGGAAGAAGCAGG - Intergenic
934224094 2:90114724-90114746 CAGTGCAGAGAGGAAGAAGCAGG + Intergenic
934236150 2:90234682-90234704 CAGTGCAGAGAGGAAGAAGCAGG + Intergenic
934847900 2:97674171-97674193 GAATGACAAGAGGAAGAAGAAGG + Intergenic
934987795 2:98900150-98900172 CAGTGGGAAGGGGAGGCAGATGG + Intronic
935331105 2:101978716-101978738 CAGTGCCCACAGCAGAAAGAGGG - Intergenic
935535216 2:104285669-104285691 CACTGCCAAGAGAAGGAGAAAGG - Intergenic
935687888 2:105700394-105700416 CAGATATAAGAGGAGGAAGATGG - Intergenic
936012801 2:108935994-108936016 CAGTGCCCACTGCAGGAAGAAGG + Intronic
936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG + Intronic
936096601 2:109535067-109535089 CAGAACCCAGATGAGGAAGATGG + Intergenic
937253355 2:120538117-120538139 CTGTGCCCAGAGGAGGAACAGGG + Intergenic
937429108 2:121823832-121823854 CAATGAGAAGGGGAGGAAGACGG - Intergenic
937646623 2:124272581-124272603 CATTGCACAGAAGAGGAAGAAGG + Intronic
937774168 2:125756060-125756082 GTGTGAGAAGAGGAGGAAGAGGG + Intergenic
938502562 2:131838009-131838031 AAGTGCCAAGAGGAGAAAAAAGG - Intergenic
939280746 2:140061369-140061391 CACTACCAAGAGGAGGAGGGAGG - Intergenic
939792242 2:146592340-146592362 CAGTGGCAAGAGAAATAAGATGG - Intergenic
940191032 2:151040158-151040180 CAGTGGCAAGAGGTAGAACAAGG + Intronic
940441185 2:153718627-153718649 CAGTGACATGAGGAGGCAGCAGG + Intergenic
943635404 2:190301462-190301484 CAATCCCCAGAGGAGGGAGAGGG + Intronic
944282057 2:197909518-197909540 CAGAGCCATGAGGAGGAAGTGGG - Intronic
945217602 2:207451263-207451285 AAGTGCCAAAGGGAGGAAGGAGG - Intergenic
945258150 2:207819579-207819601 CAGTGCCAAGAGGAATTGGAAGG - Intergenic
946058789 2:216923691-216923713 CATTGCCAGTAGGGGGAAGAAGG - Intergenic
946463370 2:219889918-219889940 CTGGGGCAAGATGAGGAAGAGGG - Intergenic
946469225 2:219940835-219940857 CAGTGCAAAATGGATGAAGATGG + Intergenic
946759104 2:222975509-222975531 CACTGCCAAGACGAAGAGGAGGG - Intergenic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
948457629 2:238114225-238114247 CAGAGCCATGGGGAGGAGGAAGG - Intronic
948692937 2:239718431-239718453 CAGGGCCAGGAGAAGGGAGATGG - Intergenic
948781513 2:240324479-240324501 CAGGGCCTGGAGGAGGCAGAAGG - Intergenic
948928885 2:241117506-241117528 GAGTGTCAGGAGGAGGGAGAAGG + Intronic
1168916333 20:1491291-1491313 CAGTGCCAGCAGCAGGAAGCAGG + Exonic
1168930079 20:1614632-1614654 CAGTTCCTAGAGAAGGAAGTAGG - Intronic
1169027537 20:2383329-2383351 CAAGGGCAGGAGGAGGAAGATGG + Intronic
1169056199 20:2623633-2623655 TGGTGCCAAGAGGTGGAATACGG - Intronic
1169149960 20:3281807-3281829 CATTGCAAAGTGGAGGAAGAGGG + Intronic
1169340962 20:4795839-4795861 GAGTGCCAGGAGGAGGAGGATGG + Exonic
1169752146 20:9005258-9005280 CAGTGACAAGAGGAGAATGAGGG + Intergenic
1169758644 20:9068495-9068517 CAGCGCCAAGAGGAGGTGGGTGG - Intergenic
1169997890 20:11579238-11579260 CATTGCAGAGTGGAGGAAGAGGG - Intergenic
1170337227 20:15283124-15283146 CAGTACCAAGGGGAGGTAGTTGG - Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170392120 20:15886971-15886993 GACTGCCAAAATGAGGAAGAAGG - Intronic
1170481271 20:16767480-16767502 CAGTGCCAAGAAAAGGAACATGG - Intronic
1170489852 20:16861938-16861960 CAGTGGACAGAGGAGGAAAATGG + Intergenic
1170706499 20:18749010-18749032 CAGGCAAAAGAGGAGGAAGAGGG + Intronic
1170792519 20:19519711-19519733 CTGTGCCAAGTAAAGGAAGAAGG + Intronic
1170994685 20:21341253-21341275 CTGAGGCAAGAGGAGGAGGATGG + Intronic
1171163611 20:22951391-22951413 CAAGGCAAAGAGGAAGAAGATGG + Intergenic
1172865526 20:38094002-38094024 CAGTGCCACGACCGGGAAGATGG + Intronic
1172929080 20:38569929-38569951 CAGGTCCAAGGGGAGGAACAGGG - Exonic
1173568885 20:44064135-44064157 GAGTTCCAAGAGTAGCAAGAGGG + Intronic
1173604898 20:44324862-44324884 CAGTGACCAGAGGAGGAAGCTGG - Intergenic
1173838154 20:46139125-46139147 CTGGGCAAAGAGGAGGGAGAGGG - Intergenic
1173956499 20:47037100-47037122 AAGTGCCAAGAGAAGCAAGGAGG + Intronic
1174147568 20:48462867-48462889 GAGTGCCATGATGAGGAAGGAGG - Intergenic
1174429250 20:50456059-50456081 CAGTGCCAAGAGGCGCAACATGG + Intergenic
1174451351 20:50622664-50622686 CAGAGCCAAGGGGTGGATGAGGG - Intronic
1175968023 20:62669334-62669356 CAGTCCCAGGAGGTGGGAGAGGG - Intronic
1176306569 21:5126651-5126673 CAGTGCCAACAGGAGATAGGTGG + Intronic
1176520339 21:7819470-7819492 CAGTACCATGAGGACGTAGAGGG + Exonic
1177004044 21:15648725-15648747 CAGTGAGAAAAGGAGGAAGAGGG - Intergenic
1177883236 21:26718818-26718840 CTTTGCAAAGAGGATGAAGACGG + Intergenic
1178085428 21:29106974-29106996 GACTGCTAAGAGAAGGAAGATGG + Intronic
1178654363 21:34449482-34449504 CAGTACCATGAGGACGTAGAGGG + Intergenic
1179818786 21:43924546-43924568 GATTGCTAACAGGAGGAAGATGG - Intronic
1179850490 21:44135379-44135401 CAGTGCCAACAGGAGATAGGTGG - Intronic
1180195396 21:46190805-46190827 CCGTGCCCAGAGGTGGCAGAAGG + Exonic
1180645344 22:17334045-17334067 CTGGGCCCAGAGGAGGAAAATGG - Intergenic
1180855395 22:19041877-19041899 CAGTGACAGGATGAGGAAGGAGG + Exonic
1181103222 22:20555352-20555374 CAGGGCTAGGAGGAGGAGGAGGG - Intronic
1181533440 22:23530082-23530104 AAGTACCATGAGGAGGAAGGGGG + Intergenic
1181591992 22:23891032-23891054 TGCTGCCATGAGGAGGAAGAGGG + Intronic
1182852797 22:33490447-33490469 CAGTGCCAAGAACATGAAAACGG + Intronic
1182888494 22:33796706-33796728 CAGAGCCAGGTGGAGGAGGAGGG + Intronic
1183332367 22:37228497-37228519 CAGAACCAAGAGGAAGGAGAAGG + Intronic
1183715156 22:39529129-39529151 CAGCTCCAGGAGTAGGAAGAAGG - Exonic
1183843942 22:40524724-40524746 CAGTTAAAAGAGGAAGAAGATGG - Intronic
1183994209 22:41620915-41620937 GAGTGCGAAGCGGAGGGAGAGGG + Exonic
1184131466 22:42519300-42519322 CAGGGGCAAGAGGAGAAGGAGGG + Intronic
1184141692 22:42581516-42581538 CAGGGGCAAGAGGAGAAGGAGGG + Intergenic
949163559 3:910516-910538 AAGGGCAAAGAGGAGGTAGAAGG + Intergenic
949459541 3:4275427-4275449 CAATGTCAAGAGGCAGAAGAGGG + Intronic
949982064 3:9508216-9508238 CAGTGCCACGATGAGAAGGAGGG - Intronic
950371316 3:12533349-12533371 TGGTGGCAAGAGGAGGGAGATGG + Intronic
951650565 3:24947138-24947160 CTGAGCCAAGAGGAGAAACATGG + Intergenic
951899307 3:27641308-27641330 CAATGCAGAGAGGTGGAAGAGGG + Intergenic
952646458 3:35664756-35664778 AAGTGCCTGGAGGAGGCAGAAGG + Intronic
952776010 3:37047334-37047356 CATTGACAAGAGGAGGAAAGGGG + Intronic
952887818 3:38022302-38022324 CTGAGACAAGAGGAGGCAGAAGG + Intronic
953853640 3:46484692-46484714 AAGTGCCCAGAGGAGGAATAAGG + Intronic
954362625 3:50130290-50130312 CAGTTTCAAGAGGCTGAAGAAGG - Intergenic
954939300 3:54356390-54356412 CAGTGCCAAGAGGAGGCCTCAGG + Intronic
956050320 3:65240986-65241008 AAGTGCCAAGAAGGGGAAGACGG - Intergenic
956664541 3:71630285-71630307 TAGTCCCAGGAGGAGGATGAGGG + Intergenic
958450343 3:94265357-94265379 CAATGCCAAGGGGATGAAGTAGG - Intergenic
959254927 3:103997296-103997318 CAGTGCAGAGAGAAGGCAGAAGG + Intergenic
960221385 3:115113456-115113478 CAGTGCCAAAAGCAGGAGGCAGG - Intronic
960284370 3:115810718-115810740 CAGGGCCAACAGGAGGAGGCTGG - Intronic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
961313175 3:126016684-126016706 CATGGCTGAGAGGAGGAAGAGGG + Intronic
962502292 3:136007800-136007822 CAAATCCATGAGGAGGAAGATGG - Intronic
964506342 3:157404248-157404270 CAGGGCCACGAGGAGGTATAAGG + Intronic
964527914 3:157634904-157634926 CAGAGCCAAGAGGAGGGATAAGG + Intronic
966757582 3:183385902-183385924 CAGTGTCCAAAGCAGGAAGAAGG - Intronic
966833562 3:184031723-184031745 AAGTGCCAAAGAGAGGAAGATGG + Intronic
966948177 3:184792329-184792351 AAGTGCCCATAGGAGCAAGATGG - Intergenic
967264492 3:187678324-187678346 CAAAGCCAAGAGAAGGAAAAGGG + Intergenic
967266821 3:187698772-187698794 CAGTGCTACGAGGAGGATGGTGG - Exonic
967622849 3:191654208-191654230 CAGTGCCAAGAAGAAAAAGCTGG + Intergenic
967727028 3:192871671-192871693 CAGAGCCAAGAGAATGAAGAGGG + Intronic
968284494 3:197500131-197500153 GAGTGAGGAGAGGAGGAAGAGGG + Intergenic
970208404 4:13680294-13680316 CAGATCCAAGATGAAGAAGAGGG - Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971282221 4:25250204-25250226 CCGTGCAAAGAAGAGGGAGAGGG + Intronic
971752876 4:30674126-30674148 AGGTGCCAAGAGGAGAAAAAAGG + Intergenic
972279605 4:37589588-37589610 GAGAGCCAAAAGGAGGAAGGAGG - Intronic
972715976 4:41646528-41646550 CGGTCCCAGGAGGAGGCAGAGGG + Exonic
973542344 4:51946897-51946919 CTGTTCCAAGAGGAGGAAATTGG - Intergenic
973711437 4:53633728-53633750 CTTGGCCCAGAGGAGGAAGATGG - Intronic
973759281 4:54101607-54101629 CAATGGCAAGAGGATGAGGACGG + Exonic
975448025 4:74490466-74490488 CAGTGACAAGATGAGGCTGAAGG - Intergenic
975546735 4:75568087-75568109 CCATGTGAAGAGGAGGAAGAGGG - Intergenic
975954535 4:79821896-79821918 CATAGCAAAGAGCAGGAAGAAGG + Intergenic
977301767 4:95275258-95275280 CAGTGCCAAGAAGAGGGGCAAGG + Intronic
978652786 4:111027297-111027319 CAGTGACAACAGGAAGAAGGAGG - Intergenic
979125203 4:116962674-116962696 CAGTCAGAAGCGGAGGAAGAGGG - Intergenic
979142630 4:117197100-117197122 CACTGCCAAGCAGAGGAGGAAGG + Intergenic
980327879 4:131371787-131371809 CATTGCCAAGACAATGAAGATGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
982260258 4:153488437-153488459 CAGGGCCCAGAGGAGGCAGCCGG + Intronic
983286489 4:165746270-165746292 CAGTACAAAGAGCATGAAGATGG + Intergenic
983302756 4:165948174-165948196 CAGTTCCAACAGGGGGAACACGG - Intronic
986088785 5:4481094-4481116 GAGTGCAAAGAGGAGGTGGACGG - Intergenic
986271730 5:6237093-6237115 CAGTGCCAAAGGGAGGCTGATGG + Intergenic
986858820 5:11903744-11903766 CAGCGGCAAGAGGAGGAGGACGG + Intronic
987923603 5:24313661-24313683 AAGTGCCCAAAGGAGAAAGAGGG - Intergenic
988238108 5:28573334-28573356 CAGTTCAAAGTGGAGGAGGATGG - Intergenic
988336293 5:29913340-29913362 AGGTGCCAAGAGGAGACAGAGGG + Intergenic
989443915 5:41506596-41506618 AATTACAAAGAGGAGGAAGATGG + Intronic
991510061 5:67366131-67366153 GAGTGAGAAGAGGAGTAAGAAGG + Intergenic
992258664 5:74948199-74948221 CACTGCAAACAGGAGGAAGCAGG + Intergenic
992568066 5:78022367-78022389 TACTTCCAAGAGGAGAAAGAGGG + Intronic
993010500 5:82477293-82477315 CAGTGACAAGAGCAGAAAGGGGG - Intergenic
993735982 5:91477273-91477295 CAGTAGGAAGAGGAGGAAGTGGG - Intergenic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995528264 5:113068040-113068062 GGGAGACAAGAGGAGGAAGAGGG + Intronic
996007111 5:118434733-118434755 CAGTGCCAAGATGAAGAAAGTGG - Intergenic
997565467 5:134882825-134882847 CCGTGGAAAGAGGAGGGAGAGGG + Intronic
998265118 5:140662181-140662203 CATTGAGAAGAGGAAGAAGATGG + Exonic
998825281 5:146095304-146095326 TAGTGACAAGGGGAGGAAAAAGG - Intronic
999034811 5:148335627-148335649 CAGAGCCAAGAGTAGGACTATGG - Exonic
999288189 5:150406802-150406824 CAGTGCCAAGGGGAGGGGCAGGG - Intronic
999477342 5:151912664-151912686 CAGAGCCAATAGAAGGAGGATGG + Intronic
1000722881 5:164730334-164730356 CATTGTCTAGAGGAGGCAGAGGG + Intergenic
1000933317 5:167279355-167279377 GAGTCCCAGGAGGAGAAAGAAGG - Intergenic
1001592933 5:172878745-172878767 CAGAGCCAAGTGGAGGCAGGCGG - Intronic
1002520848 5:179792685-179792707 CGATACCCAGAGGAGGAAGAAGG + Intronic
1002741773 5:181439584-181439606 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1004127391 6:12887014-12887036 CAAGGGGAAGAGGAGGAAGAGGG - Intronic
1005988018 6:30886099-30886121 CAGAGCCAAGCAGAGGAACACGG - Intronic
1006263223 6:32894404-32894426 CAGCGCCAAGCGGGAGAAGACGG + Intergenic
1006688745 6:35861479-35861501 CACTGCTCTGAGGAGGAAGAGGG + Intronic
1006982434 6:38157281-38157303 AAGTGCCTGGAGCAGGAAGATGG + Intergenic
1008497371 6:52146574-52146596 CACTGGCAGGAGGAGGCAGAAGG + Intergenic
1009945065 6:70333737-70333759 CAATGCCAACAGGAGAAAGCAGG - Intergenic
1010059984 6:71611314-71611336 CAGTGCTGAGAGGAGGAAAGGGG + Intergenic
1010690398 6:78904331-78904353 CAGTGGCAATAGGAGGTAAAGGG - Intronic
1010758441 6:79694291-79694313 ACGTGGTAAGAGGAGGAAGAGGG - Intronic
1012980313 6:105822755-105822777 CAGAGCCCAGGGGAGGGAGAAGG + Intergenic
1014355958 6:120410485-120410507 TAGTGCCATGAGGTAGAAGAAGG - Intergenic
1016020313 6:139230101-139230123 CAATACCAAGAGGAAGGAGAAGG - Intergenic
1016317835 6:142809355-142809377 CAGTGCCAAGAGTGAGGAGAGGG - Intronic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1017071068 6:150576039-150576061 CAGTGTCTACACGAGGAAGATGG + Intergenic
1017742483 6:157419085-157419107 CAGTCCCTAGAGGAGAAAAATGG - Intronic
1017819314 6:158038240-158038262 CAGAGCCCAGAGGACGAAAAAGG - Intronic
1017872595 6:158499774-158499796 CAGAGCCAAGCTGAGGAGGAGGG - Intronic
1017896773 6:158686862-158686884 CAGGGCCAGGAGGAGGGAGAAGG - Intronic
1017927406 6:158922283-158922305 CCGAGCCAGGAGGAGGAAGCCGG - Intergenic
1018415943 6:163602133-163602155 GAGGACAAAGAGGAGGAAGAGGG + Intergenic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1018570946 6:165209356-165209378 CACTGCAAAAATGAGGAAGATGG - Intergenic
1018571221 6:165212060-165212082 AAATGGCAAGAGGAGGAAGATGG - Intergenic
1018574480 6:165245004-165245026 CAGAGCCAGCAGGAGGAATAAGG + Intergenic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1019136178 6:169909352-169909374 CACTGGCAGGAGGAGGAAGTAGG - Intergenic
1019246913 6:170715341-170715363 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1019278349 7:187740-187762 CCCTGCCAGGAGGAGGGAGACGG - Intergenic
1019474106 7:1235849-1235871 CCGGGCCAAGTGGAGGAAGAAGG + Exonic
1020470939 7:8533834-8533856 TGGTGTCAAGGGGAGGAAGAAGG + Intronic
1020787359 7:12589096-12589118 AAGTGCTAAATGGAGGAAGAGGG + Intronic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1021843520 7:24742477-24742499 CAGTTCTGAGTGGAGGAAGAGGG - Intronic
1021853653 7:24832759-24832781 CAGAGCGAAGGGGAGGCAGAAGG + Intronic
1021975258 7:26006312-26006334 CGGGTCCAAGAGGAAGAAGATGG + Intergenic
1022777944 7:33546777-33546799 CAGTTCCAGGAGGAGGACCAGGG - Intronic
1022796546 7:33736024-33736046 CATTGCCAATAAGAGTAAGATGG + Intergenic
1023284853 7:38608435-38608457 CAGTGAAAAAAGGTGGAAGAAGG - Intronic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024839701 7:53571652-53571674 CAGACCCAGGAGAAGGAAGAGGG - Intergenic
1025790701 7:64684532-64684554 GACTTCCAAGAGGAGGAAGAAGG - Intronic
1025832814 7:65068764-65068786 CAGAGCTAAAAGGAGGAATATGG + Intergenic
1025902586 7:65758291-65758313 CAGAGCTAAAAGGAGGAATATGG + Intergenic
1026638625 7:72105750-72105772 CAGGGAGAAGAGGAAGAAGAAGG + Intronic
1026846399 7:73701136-73701158 CAGTGCCAGGCAGAGGAAGGTGG + Intronic
1027178232 7:75918549-75918571 CAGCGCCAAGAAGATGAAGAAGG - Intronic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1028116462 7:87002980-87003002 CGCTCCTAAGAGGAGGAAGAAGG + Intronic
1028411656 7:90536843-90536865 CAGGGCCAGGAATAGGAAGAAGG + Intronic
1029416153 7:100444492-100444514 CAGTGTTCAGATGAGGAAGAGGG - Intergenic
1029712997 7:102309793-102309815 CAATGCCAGGCAGAGGAAGATGG + Intronic
1030401447 7:109056345-109056367 CAGTGCAGAAAGGATGAAGATGG - Intergenic
1031244128 7:119285173-119285195 CAGTTCCAAAAGGAGTAAGAGGG - Intergenic
1032072383 7:128816247-128816269 CAGTGCCAAAAGAGGGATGAGGG - Intronic
1033134394 7:138772956-138772978 GAGAGCCAAGGGGAGGAGGAGGG + Intronic
1033511283 7:142062612-142062634 AACTGCCAAGTGGTGGAAGAGGG + Exonic
1033514400 7:142091957-142091979 AACTGCCAAGTGGTGGAAGAGGG + Intronic
1034042026 7:147887660-147887682 CAGTGGCTATATGAGGAAGAAGG + Intronic
1034091656 7:148369747-148369769 CATTGCCAGGAGGAGGCAGAAGG + Intronic
1034468510 7:151243682-151243704 CAGTGCCAAGAGGAGGAAGATGG - Exonic
1034801981 7:154060597-154060619 CAGAGCCAGGGGGGGGAAGAGGG - Intronic
1034835729 7:154350289-154350311 CAGTGACATGGGGAGGAACACGG + Intronic
1035501228 8:92612-92634 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
1035783640 8:2247329-2247351 CAATTCCAAGAGGAGGAACCAGG + Intergenic
1035808474 8:2472219-2472241 CAATTCCAAGAGGAGGAACCAGG - Intergenic
1036388315 8:8301820-8301842 GAGGGCCAAGAAGAGGCAGAGGG + Intergenic
1036574612 8:10015101-10015123 CAATGCCAAGGAGAGGAGGAAGG - Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036643228 8:10597030-10597052 CAGTGCCAAGACGAGAAAGGAGG - Intergenic
1037304545 8:17491843-17491865 CAGAGCCATGTGGTGGAAGAAGG - Intergenic
1037712008 8:21362335-21362357 ATGTTCCAAGAGAAGGAAGAGGG - Intergenic
1037785724 8:21902005-21902027 CAGTTCTGAGAGGAGGAAGCTGG - Intergenic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1041241983 8:55855991-55856013 CAGTGGCAAAAGAAGAAAGAGGG + Intergenic
1044433344 8:92134388-92134410 CAGACCCAAGAGGAGGGATATGG + Intergenic
1044669240 8:94662176-94662198 CCAAGCCAAGAGGAAGAAGATGG - Intronic
1044785790 8:95791147-95791169 CAGTGCTGATAGGAGGAAGTTGG + Intergenic
1045211709 8:100106181-100106203 CCCTGCCCAGAGGAGGAGGAAGG - Intronic
1045458166 8:102402584-102402606 AAGTGAGAAGTGGAGGAAGATGG - Intronic
1047283290 8:123464461-123464483 CAGCGGCATGAGGAGGAGGAAGG + Intronic
1047680518 8:127249674-127249696 CATTCCCAACAGGAGGAAAATGG - Intergenic
1048357780 8:133667581-133667603 GAGTGGGAGGAGGAGGAAGAGGG - Intergenic
1048477275 8:134754926-134754948 CAGAGCCAAGAGATGGGAGATGG + Intergenic
1048774985 8:137935663-137935685 CAGAGCCTAGAGGATGAAGCTGG + Intergenic
1049145721 8:141000498-141000520 GAGAGGCAGGAGGAGGAAGAGGG - Intronic
1049488773 8:142880009-142880031 CAGGGCTGAGAGGAGCAAGATGG + Intronic
1049797897 8:144504888-144504910 CAGGGCCAGGAGGAAGCAGAGGG + Intronic
1050712601 9:8482746-8482768 AAGTGGCAAGAGAAGGAAGAAGG - Intronic
1050803642 9:9646617-9646639 TAGTATAAAGAGGAGGAAGAAGG - Intronic
1050875948 9:10636599-10636621 CTATTCCAAGAGGAGGAAGTTGG - Intergenic
1051596129 9:18825971-18825993 CAGTACAAAGAGGAGGAAACAGG - Intronic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052348023 9:27429609-27429631 TAGTGGCAGGAGGAGGAAGCTGG + Intronic
1052974298 9:34400346-34400368 ATGGGGCAAGAGGAGGAAGAAGG + Exonic
1053361895 9:37493972-37493994 CAGGGCACAGAGGAGGGAGAAGG + Intronic
1053480547 9:38413434-38413456 CAGTGGGAGGAGGAGGAAGGAGG - Intronic
1055760219 9:79599089-79599111 CAGTGCCAAGAGGAGGATGGAGG + Intronic
1055928598 9:81536474-81536496 GAGGGCATAGAGGAGGAAGAGGG + Intergenic
1057187084 9:93062995-93063017 CAGTGCCAAGAGTAGGAGGCTGG - Intronic
1057220530 9:93255382-93255404 CAGTGCCCAGAGCTGGTAGACGG + Intronic
1057307478 9:93920630-93920652 CAGGCCCACGAGGAGGAGGAGGG + Intergenic
1058679879 9:107431521-107431543 CAGTGACAAGAGGGAGAGGAGGG - Intergenic
1058906122 9:109484028-109484050 CAGAGTGAAGAGGAGGAAGTTGG - Intronic
1060799424 9:126534318-126534340 CAGTGACAGAAGTAGGAAGAAGG + Intergenic
1061118632 9:128629756-128629778 CTGTGCCAAAAGGAGAGAGATGG - Intronic
1061386914 9:130295825-130295847 CAGGGCAAGTAGGAGGAAGATGG - Intronic
1061909059 9:133713238-133713260 CAGGGCCTAGAGGAGGGAGGGGG - Intronic
1062141983 9:134964326-134964348 CAGTGCCCAGTGGAGGAGGAGGG + Intergenic
1062379552 9:136280715-136280737 CAGTGCCAGGGGGAGGAGAAGGG - Intergenic
1203607684 Un_KI270748v1:70800-70822 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1185839491 X:3375420-3375442 CAGGGCAAAGAGGAAGGAGAAGG + Intergenic
1186066767 X:5774903-5774925 CATTGACAAGAGGATGAAAATGG + Intergenic
1187007614 X:15247870-15247892 CAGTGAGAGTAGGAGGAAGAAGG + Intronic
1189510726 X:41658620-41658642 CAGTGTGAAGAGGTGGGAGAGGG + Intronic
1191044244 X:56119241-56119263 AAGTGGGAAAAGGAGGAAGAGGG + Intergenic
1191715373 X:64190474-64190496 GAGGACGAAGAGGAGGAAGAAGG - Exonic
1192169014 X:68843057-68843079 CAGAGGAAAGAGGAAGAAGAAGG + Intergenic
1193377643 X:80780715-80780737 GAGTACAAAGAGGAGGAAGGTGG + Intronic
1194173064 X:90612570-90612592 CAGTGAAAAGGGGAGGAAGTAGG - Intergenic
1194973388 X:100368666-100368688 CAGTGCCCAAAAGAGGAAGAAGG + Intronic
1195641917 X:107184626-107184648 CAGAGACAAGAAGAGAAAGAGGG + Intronic
1195658582 X:107356576-107356598 AAGTGACAAGAGGAGTAAGGTGG - Intergenic
1195703816 X:107724225-107724247 CAGTGGCAGGAGGAGGCAGGGGG + Intronic
1197254635 X:124249937-124249959 CAGTGCCAAAGGGAGCAATATGG - Intronic
1197357361 X:125452128-125452150 CAGTGCCTAAAGGAGGAAAAGGG + Intergenic
1197641201 X:128970226-128970248 GAGAGGCAAGAGGATGAAGAGGG - Intergenic
1197822746 X:130557966-130557988 CAGTGCCAGGATGGAGAAGAAGG - Intergenic
1199240959 X:145546711-145546733 CAGGGCCAAGAGGGGGAAAAGGG + Intergenic
1199301439 X:146218802-146218824 CAATACCAAGATGAGGAAAAAGG - Intergenic
1199351709 X:146809860-146809882 AAGTACCAAAGGGAGGAAGAAGG + Intergenic
1199352198 X:146814633-146814655 AAGTACCAAAGGGAGGAAGAAGG - Intergenic
1199655865 X:149994932-149994954 CATTAGCAAGAGGAAGAAGAGGG - Intergenic
1200253218 X:154564741-154564763 CAGTGCCGGGTGGAGGAAGAGGG - Exonic
1200264549 X:154639674-154639696 CAGTGCCGGGTGGAGGAAGAGGG + Intergenic
1201236321 Y:11915443-11915465 CAGGGCAAAGAGGAAGGAGAAGG - Intergenic
1201528281 Y:14960948-14960970 CATTGACAAGAGGATGAAAATGG - Intergenic