ID: 1034468944

View in Genome Browser
Species Human (GRCh38)
Location 7:151245629-151245651
Sequence AGCCCGGATGCCCCACCAGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 132}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034468944_1034468952 -5 Left 1034468944 7:151245629-151245651 CCCCCTGGTGGGGCATCCGGGCT 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1034468952 7:151245647-151245669 GGGCTCCAGACGGCATCCCGGGG 0: 1
1: 0
2: 1
3: 13
4: 96
1034468944_1034468957 4 Left 1034468944 7:151245629-151245651 CCCCCTGGTGGGGCATCCGGGCT 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1034468957 7:151245656-151245678 ACGGCATCCCGGGGCGCTGGGGG 0: 1
1: 0
2: 0
3: 3
4: 95
1034468944_1034468950 -7 Left 1034468944 7:151245629-151245651 CCCCCTGGTGGGGCATCCGGGCT 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1034468950 7:151245645-151245667 CCGGGCTCCAGACGGCATCCCGG 0: 1
1: 0
2: 1
3: 7
4: 136
1034468944_1034468961 11 Left 1034468944 7:151245629-151245651 CCCCCTGGTGGGGCATCCGGGCT 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1034468961 7:151245663-151245685 CCCGGGGCGCTGGGGGTGGGCGG 0: 1
1: 0
2: 20
3: 124
4: 1053
1034468944_1034468967 29 Left 1034468944 7:151245629-151245651 CCCCCTGGTGGGGCATCCGGGCT 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1034468967 7:151245681-151245703 GGCGGGGGTGAAGCAGAAACGGG 0: 1
1: 0
2: 1
3: 20
4: 226
1034468944_1034468954 1 Left 1034468944 7:151245629-151245651 CCCCCTGGTGGGGCATCCGGGCT 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1034468954 7:151245653-151245675 CAGACGGCATCCCGGGGCGCTGG 0: 1
1: 0
2: 1
3: 2
4: 89
1034468944_1034468951 -6 Left 1034468944 7:151245629-151245651 CCCCCTGGTGGGGCATCCGGGCT 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1034468951 7:151245646-151245668 CGGGCTCCAGACGGCATCCCGGG 0: 1
1: 0
2: 1
3: 17
4: 120
1034468944_1034468965 14 Left 1034468944 7:151245629-151245651 CCCCCTGGTGGGGCATCCGGGCT 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1034468965 7:151245666-151245688 GGGGCGCTGGGGGTGGGCGGGGG 0: 1
1: 2
2: 19
3: 265
4: 2403
1034468944_1034468963 12 Left 1034468944 7:151245629-151245651 CCCCCTGGTGGGGCATCCGGGCT 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1034468963 7:151245664-151245686 CCGGGGCGCTGGGGGTGGGCGGG 0: 1
1: 0
2: 7
3: 115
4: 960
1034468944_1034468966 28 Left 1034468944 7:151245629-151245651 CCCCCTGGTGGGGCATCCGGGCT 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1034468966 7:151245680-151245702 GGGCGGGGGTGAAGCAGAAACGG 0: 1
1: 0
2: 4
3: 33
4: 484
1034468944_1034468955 2 Left 1034468944 7:151245629-151245651 CCCCCTGGTGGGGCATCCGGGCT 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1034468955 7:151245654-151245676 AGACGGCATCCCGGGGCGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 71
1034468944_1034468956 3 Left 1034468944 7:151245629-151245651 CCCCCTGGTGGGGCATCCGGGCT 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1034468956 7:151245655-151245677 GACGGCATCCCGGGGCGCTGGGG 0: 1
1: 0
2: 1
3: 8
4: 92
1034468944_1034468964 13 Left 1034468944 7:151245629-151245651 CCCCCTGGTGGGGCATCCGGGCT 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1034468964 7:151245665-151245687 CGGGGCGCTGGGGGTGGGCGGGG 0: 1
1: 1
2: 6
3: 170
4: 1431
1034468944_1034468959 8 Left 1034468944 7:151245629-151245651 CCCCCTGGTGGGGCATCCGGGCT 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1034468959 7:151245660-151245682 CATCCCGGGGCGCTGGGGGTGGG 0: 1
1: 0
2: 2
3: 20
4: 299
1034468944_1034468958 7 Left 1034468944 7:151245629-151245651 CCCCCTGGTGGGGCATCCGGGCT 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1034468958 7:151245659-151245681 GCATCCCGGGGCGCTGGGGGTGG 0: 1
1: 0
2: 3
3: 50
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034468944 Original CRISPR AGCCCGGATGCCCCACCAGG GGG (reversed) Exonic
900394765 1:2448731-2448753 AGCCAGGAGGCTGCACCAGGGGG - Intronic
901032882 1:6318519-6318541 AGTCTGAAGGCCCCACCAGGTGG + Exonic
901782328 1:11602281-11602303 AGCGGGGATGCCTCCCCAGGTGG + Intergenic
902581147 1:17408440-17408462 ATCCCCAATCCCCCACCAGGGGG + Exonic
902607070 1:17574729-17574751 ATCCCGGACTCTCCACCAGGTGG + Intronic
903581406 1:24373519-24373541 AGCCAGCAATCCCCACCAGGAGG - Intronic
903720561 1:25402523-25402545 ACCCCGGAAGCCCCACCAAATGG + Intronic
904181550 1:28669391-28669413 AGCCCGGATGCCCGCCTGGGAGG + Intronic
906062511 1:42958117-42958139 AGCCCGGACGCCCCTGTAGGTGG - Intronic
907420403 1:54343099-54343121 AGCCCGGATCCTGTACCAGGGGG + Intronic
907461407 1:54607824-54607846 AGCACAGATTCCTCACCAGGGGG - Intronic
910846207 1:91606715-91606737 AGGCCAGACGCCCCACCATGTGG + Intergenic
912540685 1:110412678-110412700 AGCCCTCATGTGCCACCAGGGGG + Intergenic
915018372 1:152757930-152757952 AGCCCGGTTGATGCACCAGGCGG + Intronic
919487188 1:198159070-198159092 AGCCCGGAGGACCCTCCCGGAGG + Intronic
919804799 1:201375217-201375239 TGCCCAGCTGCCCCTCCAGGTGG + Intronic
919929744 1:202213601-202213623 AGCCCTGCTTCTCCACCAGGAGG + Intronic
1066112245 10:32207666-32207688 AGCCCAGCAGCCCCACCTGGTGG + Intergenic
1067529722 10:47061411-47061433 TGCCCTGCTGCCCCCCCAGGAGG + Intergenic
1068161569 10:53271811-53271833 AGCCCGGTAGCTCCACTAGGTGG + Intergenic
1068947653 10:62745424-62745446 GGCCCAGATGCCCCCTCAGGAGG - Intergenic
1069566045 10:69464268-69464290 AGCCCTTCTGCCTCACCAGGTGG + Intronic
1074037311 10:109753457-109753479 AGCCTGGTAGCCCCACTAGGTGG - Intergenic
1077539194 11:3138706-3138728 AGCCCAGGAGCCTCACCAGGAGG - Intronic
1079005420 11:16788546-16788568 CGCCAGGAAGCGCCACCAGGGGG + Exonic
1079633985 11:22712408-22712430 AGCCCAGTTGCCCCACTGGGTGG + Intronic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1083266586 11:61549851-61549873 AGACAGGATTCCCAACCAGGGGG - Intronic
1083393684 11:62373793-62373815 ATCCCCAATCCCCCACCAGGGGG - Intronic
1084268027 11:68014882-68014904 TGCCCTGATGCCCCTCCTGGAGG - Intronic
1091778011 12:3197357-3197379 AGCCCTGATGCTACATCAGGAGG + Intronic
1094375983 12:29787685-29787707 AGCCCGGCTGCAGCCCCAGGAGG + Intergenic
1098640971 12:72838512-72838534 AGTCTGGAAGCCCCACCTGGGGG - Intergenic
1108104649 13:46996202-46996224 AGCCTGGAAGCCCTATCAGGTGG + Intergenic
1109266891 13:60211738-60211760 AGCCTGGTTGCTCCACCAGGGGG - Intergenic
1118896466 14:69949724-69949746 GGCCCGTGTGCCCCACCAGCAGG + Intronic
1121649264 14:95545104-95545126 AGCCTCCATGCCACACCAGGCGG - Intergenic
1122494060 14:102139669-102139691 CGCCCGGAGGCCACACCCGGGGG + Exonic
1123042856 14:105497491-105497513 ATCCCGAATGCCCCACCTGGGGG - Intronic
1127014549 15:54668927-54668949 AGCCTGGTGGCCCCACTAGGTGG + Intergenic
1127917536 15:63467497-63467519 AGCCCAGATGCCCGACCGTGGGG + Intergenic
1132679997 16:1135945-1135967 ACCCCTGAAGCCCCACCATGGGG - Intergenic
1134475430 16:14569376-14569398 AGCGCTGCTGCCCAACCAGGTGG + Intronic
1137727257 16:50665285-50665307 AGCCCAGAAGCCCCAAAAGGCGG - Intergenic
1140415014 16:74768372-74768394 GCCCTGGATGCCCCACCAGCTGG + Intronic
1143782150 17:9234516-9234538 AGCCCTGGTGCTCCACCATGGGG - Intronic
1148086703 17:44997953-44997975 AGCCCAGAGGCCCCTGCAGGGGG + Intergenic
1148871995 17:50663716-50663738 CACCAGGAAGCCCCACCAGGAGG - Exonic
1151586241 17:75010397-75010419 AGCCACCATGCCCCACCAGATGG - Intergenic
1152345280 17:79747526-79747548 TGCCCCGGCGCCCCACCAGGAGG + Intergenic
1157762689 18:50275881-50275903 AGCCCCGATGCCACATCATGGGG + Exonic
1160619698 18:80162105-80162127 AGCCGGGATGCCCCAGCATGAGG + Intronic
1162088013 19:8260098-8260120 AGCCCTGCAGCCCCACCAGCTGG - Intronic
1163670780 19:18627172-18627194 AGGCCGGAAGCCCCAAGAGGAGG - Intergenic
1166168837 19:41012511-41012533 ATCCAGGATGCCCAAACAGGAGG - Intronic
1166244383 19:41515303-41515325 TGCCCGGCTGCCCCACCATCTGG + Intergenic
925868116 2:8246550-8246572 AGCCCTAGTGCCCCAGCAGGAGG + Intergenic
926498023 2:13616260-13616282 TGCCCGGCTGCCCCACCATCTGG + Intergenic
927651490 2:24916238-24916260 GGCCTGGGTGCCCCACCACGTGG - Intronic
928402985 2:30992615-30992637 ACCCCGCAGGTCCCACCAGGAGG - Intronic
929795993 2:45058722-45058744 ACCCAGGATGCCCACCCAGGTGG + Intergenic
930005366 2:46892246-46892268 AGCCTGGAGGCCCCACCTTGAGG + Intergenic
932306227 2:70705743-70705765 AGCCTGGAAGCCCCAGGAGGTGG - Intronic
932410871 2:71546980-71547002 AGCCCAGCTGCCTCACCTGGGGG - Intronic
934017987 2:87909887-87909909 AGCCCGGATGACACACCCTGTGG + Intergenic
936400296 2:112159817-112159839 GGCCCAGATGCCCTTCCAGGTGG + Exonic
942506781 2:176650328-176650350 AGCCCGTAAGACCCACCAGCAGG - Intergenic
947134260 2:226961261-226961283 ATCCCAGCTGCCCCACGAGGAGG - Intronic
948628996 2:239289740-239289762 AGCTCTGGTGCCCCATCAGGCGG - Intronic
1169197964 20:3693476-3693498 AGGCGGGGTGCCCGACCAGGGGG + Exonic
1172604656 20:36206542-36206564 CGCCTGGATGCCCCTCCCGGAGG + Intronic
1175897615 20:62346334-62346356 AGCCCTCATGTCCCCCCAGGGGG - Intronic
1176145075 20:63561893-63561915 AGCCCGGAGGCCCCCCCCGTGGG - Exonic
1178951615 21:36990240-36990262 AGCCCAGTTGCACCACCAGGCGG - Intergenic
1179487867 21:41722440-41722462 AGGCAGGATGCCCCAGGAGGAGG + Intergenic
1179585147 21:42370043-42370065 CGCCCAGATTCCCCACAAGGGGG + Intergenic
1179627629 21:42657632-42657654 AGCCTGGATGTGCCACCAGGTGG - Intronic
1179783615 21:43718126-43718148 AGACCCAATGCCCGACCAGGCGG - Intergenic
1180744541 22:18078505-18078527 AGTCCAGGTGCACCACCAGGAGG - Exonic
1182475011 22:30572556-30572578 AGCCCGCTTCCCCTACCAGGTGG - Intronic
1184322393 22:43752507-43752529 AGCCCAGTGGCCACACCAGGTGG + Intronic
1184556030 22:45233579-45233601 AGCCCGGGTGCCCACCCGGGTGG + Intronic
1185048965 22:48543816-48543838 AGCCCGGATGCCCCGCCTGGAGG - Intronic
953853116 3:46480900-46480922 AGCCCCCATGGCCCACCTGGAGG - Intronic
953913706 3:46905329-46905351 AGACTGGGTGCCCCCCCAGGTGG + Intergenic
954290423 3:49647030-49647052 AGCCCTGCTGCCAGACCAGGGGG - Intronic
954389346 3:50260634-50260656 AGCCCCGATGCCCGCCCAGCAGG + Intergenic
954647654 3:52141316-52141338 AGCCTGGGTGCCCAAGCAGGAGG + Intronic
960071254 3:113433793-113433815 ATCCAGGATGACCCACCAGTAGG + Intronic
961990647 3:131186513-131186535 ATCCCTGATGCACCAACAGGAGG - Intronic
963852330 3:150221337-150221359 AGCCCGAGTGCACAACCAGGAGG - Intergenic
967805496 3:193711518-193711540 AGCCTGGATGCCCAGTCAGGGGG - Intergenic
972541550 4:40043555-40043577 AGTCTGAAGGCCCCACCAGGTGG + Intergenic
973345597 4:49051446-49051468 AGCCCAGATACCACCCCAGGAGG - Intronic
980927583 4:139153590-139153612 AGGCCAGATACCTCACCAGGGGG + Intronic
985310110 4:188588605-188588627 AGCCAGGATGCTCTCCCAGGAGG + Intergenic
985627153 5:995029-995051 AGGCCTGCAGCCCCACCAGGCGG - Intergenic
985988427 5:3536223-3536245 AGCCCGGATGCCACTGCTGGCGG - Intergenic
987073302 5:14358123-14358145 GGCCTGGCTGCACCACCAGGTGG - Intronic
991668230 5:69021693-69021715 AGCCACCATGCCCCACCAGCTGG - Intergenic
993934785 5:93986416-93986438 TGCCCGGCTGCCCCATCTGGGGG + Intronic
1001051256 5:168416289-168416311 AGCCCTGATCCACCACCAGTTGG + Intronic
1001435075 5:171693742-171693764 AGCCCAGGTCCCCCAGCAGGAGG - Intergenic
1001465133 5:171957445-171957467 AGCCTGGGTGCCCCACATGGAGG - Intronic
1001961631 5:175883443-175883465 AGCCCAGATCCCCTATCAGGGGG + Exonic
1013465210 6:110411999-110412021 AGCCACCATGCCCCACCAGTGGG + Intronic
1016841976 6:148533892-148533914 AACCCAAACGCCCCACCAGGAGG + Exonic
1019476720 7:1247849-1247871 ACCCCGGATCCCCCACCACCGGG + Intergenic
1019601160 7:1884477-1884499 AGCCGGGATTCCCCACCACATGG + Intronic
1027244612 7:76358757-76358779 AGCCCGGCTGGCCGAGCAGGCGG - Exonic
1028882735 7:95898240-95898262 AACCCAGAGGCCCCAGCAGGTGG - Intronic
1029175492 7:98661742-98661764 AGCCAGGATGGCACAACAGGAGG + Intergenic
1032086818 7:128888815-128888837 ACCCCGGGAGCCCCAGCAGGGGG + Intronic
1034296053 7:149973204-149973226 AGCACAGAGGCCCCACCCGGGGG + Intergenic
1034468944 7:151245629-151245651 AGCCCGGATGCCCCACCAGGGGG - Exonic
1034534644 7:151719352-151719374 AGCCCAGCTCCCCCAGCAGGAGG - Intronic
1035185742 7:157124795-157124817 GGGCAGGATGCCCCACGAGGTGG - Intergenic
1035461382 7:159041231-159041253 AGCGTGGCTGCCCCACCGGGAGG - Intronic
1037134106 8:15441788-15441810 AGACTGGATGACCCAGCAGGTGG + Intronic
1039873969 8:41569774-41569796 AGCCAGGGTGCCCTGCCAGGTGG + Intergenic
1043471691 8:80569315-80569337 CACCAGGAAGCCCCACCAGGAGG - Intergenic
1048280564 8:133102548-133102570 AGCCCTGATGCTCCACCGGTAGG - Intronic
1048446559 8:134497503-134497525 AGCCGGGATGCCCCAGCTGCTGG + Intronic
1048446574 8:134497561-134497583 AGCCGGGATGCCCCAGCTGCTGG + Intronic
1048446629 8:134497797-134497819 AGCCGGGATGCCCCAGCAGCTGG + Intronic
1048446644 8:134497856-134497878 AGCCGGGATGCCCCAGCTGCTGG + Intronic
1049578892 8:143401831-143401853 AGCCAGGATGCCCCGCCCGCTGG - Intergenic
1057824085 9:98358919-98358941 AGCCTGGATTCCACCCCAGGTGG - Intronic
1060281392 9:122218159-122218181 AGACTGGAAGCCCCTCCAGGAGG + Intronic
1061188936 9:129070711-129070733 AGCCAGGATGCCCCAGGTGGGGG + Exonic
1061997550 9:134194172-134194194 AGCCCTAATGCCACCCCAGGCGG + Intergenic
1062081746 9:134627715-134627737 AGCCCGGCTTCCACCCCAGGTGG - Intergenic
1062408347 9:136408797-136408819 AGCGGGGAAGCCCCACCTGGGGG - Intronic
1185461243 X:333637-333659 GGGTCGGAGGCCCCACCAGGAGG - Intergenic
1186464494 X:9774415-9774437 AGCCCCCTCGCCCCACCAGGCGG - Intronic
1191254174 X:58272729-58272751 AGCCCTGGTGCCAGACCAGGGGG - Intergenic
1194935227 X:99939904-99939926 ATCCCCAATCCCCCACCAGGCGG + Intergenic
1199126545 X:144129122-144129144 AGCCCGGATGACACACCCTGTGG - Intergenic
1200117433 X:153775498-153775520 GGCCAGGAAGCCCCAGCAGGTGG + Intronic
1200134263 X:153867305-153867327 AGCCCGGAGCCCCTTCCAGGTGG + Intronic