ID: 1034469076

View in Genome Browser
Species Human (GRCh38)
Location 7:151246148-151246170
Sequence AGCCGCAGAGAGCAAAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034469076_1034469079 -9 Left 1034469076 7:151246148-151246170 CCAGGGCTTTGCTCTCTGCGGCT 0: 1
1: 0
2: 1
3: 44
4: 254
Right 1034469079 7:151246162-151246184 TCTGCGGCTTGGTTGAGGTCCGG 0: 1
1: 0
2: 0
3: 10
4: 218
1034469076_1034469080 -2 Left 1034469076 7:151246148-151246170 CCAGGGCTTTGCTCTCTGCGGCT 0: 1
1: 0
2: 1
3: 44
4: 254
Right 1034469080 7:151246169-151246191 CTTGGTTGAGGTCCGGTACCCGG 0: 1
1: 0
2: 0
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034469076 Original CRISPR AGCCGCAGAGAGCAAAGCCC TGG (reversed) Intronic
900113657 1:1019894-1019916 CGCCGCCGCGAACAAAGCCCCGG - Intergenic
900205625 1:1430936-1430958 AGCCCCGGAGAGCAGAGGCCTGG + Intergenic
900697395 1:4020851-4020873 AGCCTCAGAGAGCTCAGCCCTGG - Intergenic
901294970 1:8154173-8154195 GGCCACAGAGCGCAAAGGCCGGG - Intergenic
902370711 1:16005215-16005237 AACCCCAGAGAGGAAAGCCCTGG - Intronic
902385309 1:16072791-16072813 AGACACAGAGAGAAAGGCCCAGG + Intronic
902404665 1:16176026-16176048 GGCTGCGGAGAGCAAAGCCCAGG + Intergenic
902566411 1:17314489-17314511 AGCAGCAGACAGCTCAGCCCAGG - Intronic
903147457 1:21383815-21383837 AGGCAGAGAGAGCCAAGCCCAGG - Intergenic
903703956 1:25271439-25271461 AGCCCCAGAGAATAAAGCCAGGG - Intronic
903723284 1:25421877-25421899 AGCCCCAGAGAATAAAGCCAGGG + Intronic
903932011 1:26867746-26867768 AGATGGAGAGAGCTAAGCCCAGG + Intergenic
904353824 1:29925850-29925872 ATCGGCAGAGACAAAAGCCCAGG - Intergenic
904355152 1:29933919-29933941 AGCAGCAGAGAACCAGGCCCTGG - Intergenic
904453581 1:30632630-30632652 AGCCAGTCAGAGCAAAGCCCAGG + Intergenic
905263994 1:36738709-36738731 ACACGCAGAGAGCAGGGCCCTGG - Intergenic
905854150 1:41296382-41296404 AGTTGCAGAGAGCATAGCCCTGG - Intergenic
905923524 1:41734142-41734164 AGCCTCAGAGAGCCCACCCCAGG - Intronic
907373059 1:54015458-54015480 AGCTGCAGAGGGCAAGGACCAGG - Intronic
907643088 1:56212303-56212325 AGACACAGAGAGAAAACCCCTGG + Intergenic
907719352 1:56957153-56957175 AGAAGCAGAGATCAAAGCCAAGG - Intronic
908238779 1:62171653-62171675 AGCCGCAGAGACCTCTGCCCTGG - Intergenic
909197637 1:72648293-72648315 CTCCGCAGAGTGCACAGCCCAGG - Intergenic
910129276 1:83884281-83884303 ACCCTCAGAGAGAAAAGCACAGG + Intronic
913113876 1:115679413-115679435 AGCCCCTCAGAGCAAAGTCCTGG - Intronic
913451834 1:118997927-118997949 AGCAGCACAGAGCAAACGCCTGG - Intergenic
915558399 1:156672963-156672985 AGATGCAGAGATCAGAGCCCAGG - Exonic
916269679 1:162927096-162927118 AGCTGCCTAGAGCTAAGCCCAGG - Intergenic
916851251 1:168706519-168706541 AGCCACAGAGAACAATCCCCAGG + Intronic
919849242 1:201661397-201661419 TGCTGGACAGAGCAAAGCCCTGG + Intronic
921571923 1:216790028-216790050 AGGGGCAGAGAGCAAAGTTCAGG - Intronic
923193727 1:231644342-231644364 AGCAGTAAAGAGCAAAGCACAGG - Intronic
1063173475 10:3530520-3530542 AGCCGGAGAGAGCAGAGGCCAGG + Intergenic
1064276841 10:13914043-13914065 AGCAGCTGAGGTCAAAGCCCTGG + Intronic
1065354104 10:24822381-24822403 AGCTGCAGAAAGCAAAACCGCGG + Intergenic
1067372543 10:45698956-45698978 AGACAAAGAGAGGAAAGCCCCGG + Intergenic
1067387236 10:45827168-45827190 AGACAAAGAGAGGAAAGCCCCGG - Exonic
1067418893 10:46130083-46130105 AGACAAAGAGAGGAAAGCCCCGG + Intergenic
1067447041 10:46357439-46357461 AGACAAAGAGAGGAAAGCCCCGG + Intergenic
1067504245 10:46836672-46836694 AGACAAAGAGAGGAAAGCCCCGG + Intergenic
1067590341 10:47503321-47503343 AGACAAAGAGAGGAAAGCCCCGG - Exonic
1067637463 10:48011423-48011445 AGACAAAGAGAGGAAAGCCCCGG - Intergenic
1067738097 10:48874725-48874747 AGCCCCAGAGACCAGAGACCAGG - Intronic
1067876027 10:50008911-50008933 AGACAAAGAGAGGAAAGCCCCGG + Exonic
1070134060 10:73675852-73675874 AGACAAAGAGAGGAAAGCCCCGG - Exonic
1070256384 10:74816146-74816168 AACTGCAGAAAGCAAAGCCATGG - Intergenic
1070502493 10:77084588-77084610 AGCCACAGACTGCCAAGCCCAGG + Intronic
1070940391 10:80340149-80340171 AGCAGCAGAGGGGAGAGCCCTGG + Intronic
1071717820 10:88114723-88114745 AGAGGCTGAGAACAAAGCCCAGG - Intergenic
1072335172 10:94391430-94391452 AGGCACAGAGAGGGAAGCCCAGG - Intergenic
1072936048 10:99714626-99714648 AGCACCAGTGAGCAAAGCCAAGG + Exonic
1074121404 10:110496855-110496877 CCCCGCAGCTAGCAAAGCCCTGG + Intergenic
1074771437 10:116737425-116737447 AGCATCTGAGACCAAAGCCCAGG + Intronic
1074899007 10:117801023-117801045 AGCCGCTGTGTGCAAGGCCCTGG + Intergenic
1075687182 10:124372409-124372431 AGCCGGGGAGAGCATGGCCCTGG + Intergenic
1075783708 10:125033788-125033810 AGGCACTGAGAGTAAAGCCCTGG + Intronic
1076287552 10:129314957-129314979 AACCTCTGAGAGCACAGCCCTGG - Intergenic
1076601952 10:131663072-131663094 AGACCCACAGAGCAGAGCCCAGG + Intergenic
1076619097 10:131775639-131775661 AGCGGCAGAGAGGCAGGCCCCGG + Intergenic
1076787888 10:132760069-132760091 AGCTTCAGAGAGCAGAGCACCGG - Intronic
1076996012 11:297958-297980 AGCAGCAGAGATCAAAGGCCTGG + Intergenic
1077454748 11:2671848-2671870 TGCCCCAGGGAGCCAAGCCCTGG + Intronic
1080037261 11:27722527-27722549 AGCCGCGGAGAGCGGAGCCGCGG + Intergenic
1080396191 11:31892256-31892278 AACTGCAGAAAGCAAAACCCTGG - Intronic
1081426848 11:42934703-42934725 AGGCCCAGAGAGCAGAGCCAGGG + Intergenic
1082800403 11:57410032-57410054 AGGCACAGAGGGCGAAGCCCAGG + Exonic
1083544414 11:63538115-63538137 AGCAGCAGAGACCAGAGCCAGGG + Intronic
1083871350 11:65490304-65490326 AGCCAAAGACAGCAAAGACCAGG + Intergenic
1084169800 11:67395651-67395673 GTCCTCCGAGAGCAAAGCCCTGG + Intronic
1084804110 11:71566915-71566937 AGGAGAAGAGGGCAAAGCCCGGG + Intronic
1086816472 11:91378473-91378495 AGCTGCAGAAAGCAAAGCCACGG - Intergenic
1088480353 11:110291245-110291267 AGCCCCGGAGTTCAAAGCCCTGG + Intronic
1088811788 11:113397276-113397298 AGTCCCAGAGAGCAAGGCCCTGG + Exonic
1092185356 12:6475099-6475121 GGCCGCAGAGAGCACAGGGCTGG + Intergenic
1092242014 12:6841049-6841071 AGCCCAGGAGAGCAGAGCCCAGG - Intronic
1095362918 12:41365887-41365909 ACTGGCAGAGAGCAAAGGCCAGG - Intronic
1096387484 12:51204413-51204435 AGCCGCAGGGTCCAAAGCTCTGG + Intronic
1096757998 12:53816154-53816176 AGCAGCAGAAAACAAGGCCCAGG - Intergenic
1096770931 12:53935668-53935690 AGCAGCCGAGAGCAGAGCCGGGG + Intergenic
1101343463 12:103863730-103863752 AGCCTCAGTGAGCAAAGAGCAGG - Intergenic
1101904085 12:108812478-108812500 AGCTGCAGAGAGCACAGGACGGG + Intronic
1103696409 12:122819307-122819329 AGCGACAGATGGCAAAGCCCTGG - Intronic
1104995894 12:132656197-132656219 AGCTGCAGTGAGCCAAACCCAGG + Intronic
1106575550 13:30971033-30971055 AGCCCCAAAGAGGAAAGCTCTGG - Intronic
1107399004 13:40050025-40050047 AGTCTCACAGAGCAGAGCCCGGG + Intergenic
1107724601 13:43285985-43286007 AGCTGCATAGAGGAAAGCCCTGG + Intronic
1108060471 13:46528125-46528147 AGCTGCAGAAAGCAAACCCATGG + Intergenic
1108359649 13:49657534-49657556 ATCAGCAGAGAGCAAAGCCCTGG + Intergenic
1112690853 13:101892448-101892470 AACAGCAGAGAGGAAATCCCTGG + Intronic
1112696155 13:101950667-101950689 ACCTGCTGAGAGCAAAGGCCTGG - Intronic
1113415248 13:110123783-110123805 AGACACAGAGGGCAAAGCCCTGG - Intergenic
1115158041 14:30362465-30362487 AGTTGCAGATTGCAAAGCCCAGG - Intergenic
1117078969 14:52132151-52132173 AGCTACAGACAGCCAAGCCCTGG - Intergenic
1119661962 14:76458658-76458680 AGCAGCTGAGAGCAAAGCATGGG + Intronic
1120225247 14:81783917-81783939 ATCTGCTGAGAGCAGAGCCCAGG - Intergenic
1121603803 14:95225813-95225835 AGGCCCAGAGAGGAAAGCCCAGG - Intronic
1122421685 14:101581906-101581928 AGCTGCAGAGAGCAGAGTCCTGG + Intergenic
1122598895 14:102911566-102911588 AGCCACTGAGAGGACAGCCCGGG - Intergenic
1124177700 15:27441725-27441747 AGGCGCAGAGAAGAAAGCACAGG - Intronic
1125518674 15:40336605-40336627 AGCCACAGGCAGCAAAGCCCGGG - Exonic
1126713848 15:51491704-51491726 AGCCTCAGAATGAAAAGCCCAGG + Exonic
1128733826 15:70039323-70039345 AGTGGCAGATAGCAAAGCCCCGG - Intergenic
1130253377 15:82314852-82314874 AGCTGCAGAGAAGAAAGCCAAGG - Intergenic
1130546047 15:84858122-84858144 CTCAGCAGAGAGCATAGCCCAGG + Exonic
1132780455 16:1621565-1621587 AGCCCCAGACAGCACACCCCAGG - Intronic
1133337580 16:5016009-5016031 AGCCACAGAGACCCATGCCCAGG + Exonic
1133398228 16:5465250-5465272 AGCAGCAGAGAAGAAAGGCCAGG - Intergenic
1133998611 16:10765896-10765918 AGCCACAGATAGCAAGGCCAGGG + Intronic
1138549702 16:57740678-57740700 CTCCGCAGGGAGCAAAGCACAGG - Intronic
1138647567 16:58436116-58436138 AGGGGCAAAGAGCAGAGCCCAGG - Intergenic
1141136675 16:81470200-81470222 AGCAGCAGAGAGCTGAGGCCAGG - Intronic
1141485013 16:84333219-84333241 CACAGCAGAGAGCAAAGCCGTGG + Intergenic
1142287373 16:89176939-89176961 TGCCCCAGAGAGCATGGCCCGGG + Intronic
1142604625 17:1074654-1074676 AACCCCAGATAGCAAAGCACAGG + Intronic
1144520146 17:15947694-15947716 AGCCCCTGAGAGGGAAGCCCTGG - Intronic
1144771223 17:17760650-17760672 AGCCGAGGAGACCAAGGCCCAGG - Intronic
1145801739 17:27691085-27691107 AGCCTCAGGGATCAAAGTCCTGG + Intergenic
1146315781 17:31805777-31805799 AGCCACAGAGACCACAGCCCTGG - Intergenic
1147320420 17:39642579-39642601 TGCAGCAGGGAGCAAAGCACAGG + Intronic
1147589185 17:41670427-41670449 AGCTCCCAAGAGCAAAGCCCTGG + Intergenic
1147866136 17:43553765-43553787 AGCCACAGAGCACAGAGCCCAGG + Intronic
1149265249 17:54921093-54921115 AGACGCAAAGGACAAAGCCCGGG - Intronic
1149494127 17:57106331-57106353 AGTCGCAGACGCCAAAGCCCAGG + Exonic
1150872560 17:68929675-68929697 ACCAGCATAGAGCAAACCCCAGG + Exonic
1152357689 17:79814754-79814776 AGATGCGGAGATCAAAGCCCAGG + Intergenic
1153603654 18:6809020-6809042 AGAAGCAGAGATCAAAGCTCAGG - Intronic
1153796147 18:8624018-8624040 GGCTGCAGAGGGCAAGGCCCTGG - Intronic
1154297438 18:13162890-13162912 AGCAGGAGAGAGGAAAGGCCGGG + Intergenic
1155514631 18:26612181-26612203 AGCTGCACAGAGAGAAGCCCTGG - Intronic
1158877034 18:61743471-61743493 GGCCCCACAGAGCAAGGCCCAGG - Intergenic
1159325460 18:66910130-66910152 AGTGGCAGAGAGGAAAGACCAGG - Intergenic
1159944529 18:74434540-74434562 GGGCACAGAGGGCAAAGCCCTGG + Exonic
1160009223 18:75090737-75090759 AGGCGCTGATAGCAAAGCCCGGG - Intergenic
1160709053 19:542410-542432 AGACGCTGAGATCAACGCCCAGG - Intergenic
1161473172 19:4471404-4471426 AAGTGCAGAGAGCGAAGCCCAGG + Intergenic
1161585598 19:5103800-5103822 AGCCTCACAGAGCAAAAGCCAGG - Intronic
1162452981 19:10765899-10765921 AGCCCCAGTGTGCAAAGCACTGG + Intronic
1163189983 19:15670566-15670588 AGGCTCAGGGAGCAAAGCCAGGG - Intergenic
1165153378 19:33773548-33773570 AGCCCCAGAAAGCCCAGCCCAGG - Intergenic
1165259104 19:34597758-34597780 AGCAGCAGAGAGCGGGGCCCAGG + Intronic
1166342369 19:42146361-42146383 TGTCTCAGACAGCAAAGCCCAGG - Intronic
1166794096 19:45415808-45415830 AGGCCCAGAGAGCAAACCACTGG - Intronic
1167718067 19:51156980-51157002 AGTAGCTGAGAGCAAAGGCCAGG - Intergenic
1168145509 19:54418286-54418308 AGGCGGAGAGAGCCAAGGCCCGG - Intronic
925044907 2:765831-765853 AGCAGCTGAGAGGAAAGCCTGGG + Intergenic
925237426 2:2292026-2292048 AGGCCCAGAGAGCAGCGCCCTGG - Intronic
925267621 2:2577556-2577578 AGCCACAGAGACCAAGGCCCAGG - Intergenic
925289189 2:2735539-2735561 AGACTCAGAGAGCAGAGCCCAGG + Intergenic
925289199 2:2735611-2735633 AGGCTCAGAGAGCAGAGCCCAGG + Intergenic
925289214 2:2735720-2735742 AGACTCAGAGAGCAGAACCCAGG + Intergenic
925289223 2:2735792-2735814 AGTCTCAGAGAACAGAGCCCAGG + Intergenic
925289233 2:2735864-2735886 AGGCTCAGAGAGCAGAGCCCAGG + Intergenic
925289243 2:2735936-2735958 AGACTCAGAGAGCAGAGCCCAGG + Intergenic
925289249 2:2735971-2735993 AGACTCAGAGAGGAGAGCCCAGG + Intergenic
925289254 2:2736006-2736028 AGACTCAGAGAGCAGAGCCCAGG + Intergenic
925289265 2:2736078-2736100 AGACTCAGAGAGCAGAGCCCAGG + Intergenic
925289270 2:2736113-2736135 AGACTCAGAGAGCAGAGCCCAGG + Intergenic
925289276 2:2736148-2736170 AGACTCAGAGAGGAGAGCCCAGG + Intergenic
925289281 2:2736183-2736205 AGACTCAGAGACCAGAGCCCAGG + Intergenic
925289299 2:2736292-2736314 AGACTCAGAGAGCAGAGCCCGGG + Intergenic
925289305 2:2736327-2736349 AGACTCAGAGAGCAGAGCTCGGG + Intergenic
925289315 2:2736397-2736419 AGACTCAGAGAGCAGAGCCCAGG + Intergenic
925289325 2:2736469-2736491 AGACTCAGAGAGCAGAGCCCAGG + Intergenic
925289330 2:2736504-2736526 AGACTCAGAGAGCAGAGCCCAGG + Intergenic
925289340 2:2736576-2736598 AGACTCAGAGAGCAGAGCCCAGG + Intergenic
925289345 2:2736611-2736633 AGACTCAGAGAGCAGAGCCCAGG + Intergenic
925289355 2:2736683-2736705 AGACTCAGAGAGCAGAGCCCAGG + Intergenic
925289360 2:2736718-2736740 AGACTCAGAGAGCAGAGCCCAGG + Intergenic
925289369 2:2736790-2736812 AGACTCAGAGAGCAGAGCCCAGG + Intergenic
925289375 2:2736825-2736847 AGACTCAGAGAGCAGAGCCCGGG + Intergenic
925289381 2:2736860-2736882 AGACTCAGAGAGCAGAGCCCGGG + Intergenic
925845343 2:8028727-8028749 AACCCCAGACAGCACAGCCCTGG + Intergenic
932238653 2:70141053-70141075 AGCCCCAGAGGGCAAAGACAGGG - Intergenic
932290605 2:70574782-70574804 AACCGCAGAAAGCAAAACCACGG - Intergenic
932564054 2:72894596-72894618 CACCCCAGAGAGCTAAGCCCTGG + Intergenic
933400507 2:81790665-81790687 AGCAAAAGAAAGCAAAGCCCTGG + Intergenic
935316708 2:101842141-101842163 TGCAGCAGAGAGAAAAGCCTGGG - Intronic
936984210 2:118292631-118292653 AGCCAAAGAGAGCAAAGTTCTGG - Intergenic
938241901 2:129748566-129748588 AGACCCAGAGAGCTAAGCCTTGG + Intergenic
938900400 2:135794564-135794586 GGCCTCAGAGAGCACAGCCAAGG + Intronic
940205043 2:151193315-151193337 AGCCACAGAGACCATGGCCCAGG + Intergenic
942492952 2:176508180-176508202 AGCCACAGGGAGCAATGGCCTGG - Intergenic
945590188 2:211719525-211719547 AGCAGCAGTGAACAAAGACCTGG - Intronic
945935734 2:215901121-215901143 TGCCCCACACAGCAAAGCCCAGG + Intergenic
947553733 2:231068486-231068508 AACCACAGAGAGCAAAACCATGG - Intronic
947632402 2:231662576-231662598 ACCTGCAGACAGCGAAGCCCTGG - Intergenic
948486214 2:238282919-238282941 AGCCTGAGAGAGCGAAGCCCAGG - Intronic
948688919 2:239690002-239690024 TGGCCCAGAGAGCAGAGCCCTGG + Intergenic
1169146478 20:3255820-3255842 AGCCACTGAGAGCAAACTCCAGG - Intronic
1169345493 20:4824896-4824918 AGCAGCAGAGCTCCAAGCCCCGG - Intergenic
1170569817 20:17626438-17626460 AGCCGCAGAGCCCAAATGCCAGG + Intronic
1172249047 20:33465962-33465984 AGCCGGTGTGGGCAAAGCCCTGG + Intergenic
1172519870 20:35559558-35559580 AGCTGCACAGAGCAGAGCTCGGG + Intergenic
1173745249 20:45431766-45431788 ATCTCCAGAGAGCAGAGCCCAGG - Intergenic
1174180350 20:48670451-48670473 AGCAGGAGAGAGCAGAGGCCAGG - Intronic
1175608964 20:60334348-60334370 AGGTGCTGTGAGCAAAGCCCAGG + Intergenic
1175683253 20:61006653-61006675 GGCAGCTGAGAGCAAGGCCCTGG - Intergenic
1175840169 20:62021572-62021594 AGCCGCAGTCCGCAGAGCCCCGG - Intronic
1176058376 20:63160860-63160882 AGGTGCAGAGACCAAAGCCAGGG + Intergenic
1176274610 20:64256711-64256733 TGGCGCAGGGAGCAAGGCCCTGG - Intronic
1176289484 21:5036542-5036564 ACCCGCAGAGAGCATGGCCTTGG - Intronic
1177942430 21:27427595-27427617 AGCAGTAGAGAGCAAAACCGTGG - Intergenic
1178697623 21:34807969-34807991 TGCAGCAGGGAGCAAAGCTCCGG + Intronic
1179670389 21:42942869-42942891 TGCACCAGAGAGCAGAGCCCTGG - Intergenic
1179709334 21:43203937-43203959 AGCCACAGAAGGAAAAGCCCAGG - Intergenic
1179867746 21:44227045-44227067 ACCCGCAGAGAGCATGGCCTTGG + Intronic
1179974465 21:44856290-44856312 AGCAGCAGATGGCAATGCCCAGG + Exonic
1180752796 22:18136741-18136763 AGGAGCAGAGAGCAAAGCAAAGG + Intronic
1181969389 22:26678765-26678787 CCCTGCAGAGTGCAAAGCCCAGG + Intergenic
1182320107 22:29473254-29473276 AGCTGCAGAGAGACAAGCCAGGG + Intergenic
1183525098 22:38317886-38317908 TGCCGCAGAGAACACAGGCCAGG + Intronic
1184572221 22:45332689-45332711 ATCTGCAAACAGCAAAGCCCAGG + Exonic
1203295451 22_KI270736v1_random:39173-39195 AGCAGCAGGGTGCAAAGCTCAGG + Intergenic
950547138 3:13645196-13645218 AGACACAGAGGGCAAAGTCCAGG + Intergenic
953465563 3:43116394-43116416 AGCCACATAGAGCAAAGGCCAGG + Intergenic
954125227 3:48524206-48524228 AGGGGAAGAGAGCAAAGACCTGG + Intronic
954425961 3:50443266-50443288 AGCGGGAGAGAGCAGAGCCAGGG - Intronic
954912341 3:54121150-54121172 CGGGGCAGAAAGCAAAGCCCTGG + Intergenic
955487222 3:59447424-59447446 AGAGGCAGGGAACAAAGCCCTGG - Intergenic
962395838 3:135014773-135014795 AGTCACACAGAGCAAGGCCCTGG + Intronic
968045697 3:195622880-195622902 AGCCACAGTCAGCAAGGCCCTGG + Intergenic
968064410 3:195750645-195750667 AGCCACAGTCAGCAAGGCCCTGG + Intronic
968308959 3:197667207-197667229 AGCCACAGTCAGCAAGGCCCTGG - Intergenic
969271812 4:6108186-6108208 AGCTGCTGAGAGCCAAGCCCAGG + Intronic
969638634 4:8383662-8383684 AGCAGCAGAGAGCCACGGCCTGG - Intronic
972987943 4:44787840-44787862 AGCTACAGATAGCAAAGCCTTGG - Intergenic
982115738 4:152096986-152097008 CTCCTCAGAGAGCAAAGCCTTGG - Intergenic
984113586 4:175649980-175650002 AGGGGCAGAGAGCAGAGCCACGG + Intronic
985812960 5:2103599-2103621 GGCTGCACAGAGAAAAGCCCAGG - Intergenic
985908864 5:2863784-2863806 GGCTGCAGAGATCCAAGCCCAGG + Intergenic
987595147 5:19988330-19988352 AGCCGCGGAGAGGAGAGCCAGGG - Intronic
991950704 5:71944503-71944525 AGCCGCAGAGAGCTCAGCCTTGG - Intergenic
996065348 5:119072906-119072928 AAGAGCAGAGAGCAATGCCCAGG - Intronic
996332561 5:122346399-122346421 AGCCACACAGAGCAAATCACAGG - Intronic
997136203 5:131329084-131329106 AGCCTTAGAGAGGAAAGCTCAGG - Intronic
997893227 5:137693711-137693733 AGCAGCTGAGAGCAAAGGCCTGG - Intronic
998232935 5:140373025-140373047 AACCACAGGGAGCCAAGCCCAGG - Intronic
999992299 5:157060677-157060699 AGCCACAGAGAGCCAAGACAGGG + Intergenic
1001688558 5:173614958-173614980 AACCGCAGAAAGCAAAACCTTGG + Intronic
1003174127 6:3742631-3742653 AGCCTCAGAGTTCACAGCCCCGG + Intronic
1005762490 6:28980188-28980210 AGCCACAGAGATCAAGGACCTGG - Intergenic
1006948514 6:37801757-37801779 AGAAGAAGAGAGAAAAGCCCAGG + Intergenic
1010107126 6:72182851-72182873 AGCCCCGGAGCTCAAAGCCCAGG + Exonic
1011126767 6:84015918-84015940 AAGTGCAGAGAGCAGAGCCCTGG + Intergenic
1011734590 6:90297628-90297650 AGCCGCAGAAAGGAAAGGCAGGG - Intergenic
1012361102 6:98381577-98381599 AGCAGCACAGGGCAAAACCCTGG - Intergenic
1012847418 6:104408163-104408185 AGACACAGAGAACAAAGACCTGG + Intergenic
1014289968 6:119547118-119547140 TCCTGCAGAGAGCAGAGCCCAGG - Intergenic
1014622216 6:123682212-123682234 ATCCTCAGTGAGCAGAGCCCTGG + Intergenic
1015789322 6:136950658-136950680 AGGGTCAGAGACCAAAGCCCAGG + Intergenic
1016904857 6:149138259-149138281 AGGCTCACAGAGCCAAGCCCGGG + Intergenic
1017044555 6:150334866-150334888 AGCCCCAAAGAGAAAAACCCAGG + Intergenic
1017741940 6:157414296-157414318 AGATGAAGAAAGCAAAGCCCAGG - Intronic
1018640698 6:165901406-165901428 CGGCACAGAGAACAAAGCCCAGG + Intronic
1018767631 6:166946246-166946268 AGGCTCAGAGAGCACAGGCCTGG - Intronic
1019414401 7:920676-920698 AGCCCCCGAGAGTAAAGCCCGGG + Intronic
1019489898 7:1307449-1307471 AGCTGCAGAGTGCAATTCCCAGG - Intergenic
1020017330 7:4838581-4838603 ACCTGCAGAGAGCCCAGCCCTGG - Intronic
1020654785 7:10916461-10916483 AGCCACAGAGAACAAAGAACTGG + Intergenic
1021121629 7:16802071-16802093 AACCGCAGAAAGTAAAACCCTGG - Intronic
1021538521 7:21731634-21731656 AACCTCAGAAAGCAAAGCCATGG - Intronic
1022795095 7:33725817-33725839 AACAGCAGATAGCAAAGCCAGGG + Intergenic
1024930675 7:54664436-54664458 AGGCGCAGAGAGCCTGGCCCGGG + Intergenic
1025785422 7:64639406-64639428 ACCCGCTGTGAGCAAAGACCAGG - Intergenic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1031115999 7:117669466-117669488 AACCACAGAGAGCAAAACCTTGG + Intronic
1032791979 7:135249037-135249059 AGCCCCAAAGTGCCAAGCCCTGG + Intronic
1033302872 7:140201858-140201880 AGGGGCTGAGAGCAAAGCTCTGG - Intergenic
1033741883 7:144282426-144282448 TGCCGCGGAGAGCTAGGCCCGGG + Intergenic
1033752018 7:144367188-144367210 TGCCGCGGAGAGCTAGGCCCGGG - Exonic
1034189978 7:149206578-149206600 AGCCACGGAGAGCAAAGGCCGGG + Intronic
1034469076 7:151246148-151246170 AGCCGCAGAGAGCAAAGCCCTGG - Intronic
1036823188 8:11955834-11955856 CGCCGCAGGGAGGAAAGCCTGGG + Intergenic
1039881927 8:41630530-41630552 CTCCGCAGAGAGCTAAGCCCAGG + Intergenic
1041109798 8:54473560-54473582 ATACTCAGAGAGCAAAGCCCTGG + Intergenic
1043477795 8:80622167-80622189 AGAGGCAGAGAGAAGAGCCCAGG + Intergenic
1048284831 8:133133653-133133675 ATCTGCAGGTAGCAAAGCCCTGG + Exonic
1049213396 8:141396915-141396937 GGTCCCAGAGAGCACAGCCCAGG - Intronic
1049302149 8:141877232-141877254 ACAGGCAGAGAGCAAATCCCAGG + Intergenic
1049798733 8:144508163-144508185 AGCCCCAGAGGGCACAGCTCTGG + Intergenic
1050257416 9:3809821-3809843 AGCTGCACAGAGCAATGCCAAGG - Intergenic
1052118643 9:24680510-24680532 ATCCACAGAGAGCAAAGCAGAGG - Intergenic
1057172058 9:92968963-92968985 ACCCACAGTGAGCAAGGCCCAGG - Intronic
1058611112 9:106776732-106776754 AGGAGCAGAGAGGAAAGGCCAGG - Intergenic
1059337368 9:113577683-113577705 AGCAGCATAGGCCAAAGCCCCGG - Intronic
1059494526 9:114698643-114698665 AAACGCAGAGAGAGAAGCCCGGG - Intergenic
1061087727 9:128409159-128409181 AGCCGCCCAGAGCAGAGGCCTGG + Intergenic
1061237635 9:129351853-129351875 GGCCCCAGAGAGAAAAGACCAGG - Intergenic
1061511077 9:131061251-131061273 CCCCGCAGAGGGCCAAGCCCCGG + Intronic
1061646610 9:132007846-132007868 GACCACAGAGAACAAAGCCCGGG + Intronic
1062187991 9:135228829-135228851 TGCAGGTGAGAGCAAAGCCCAGG - Intergenic
1062397131 9:136357038-136357060 AGCCCCAGAGGGCAGAGCCAGGG + Intronic
1062614632 9:137390837-137390859 AGCCGAGGAGAGAAAGGCCCGGG + Intronic
1062730084 9:138103793-138103815 AGCACCAGAGAGGAAAGCTCTGG - Intronic
1187242184 X:17523420-17523442 AGCAGCAGAGATCAAGGCCTGGG - Intronic
1191675255 X:63785883-63785905 AGCCGCAGAGGGTAAAGTCGAGG - Intergenic
1191746577 X:64495631-64495653 GGCCCCAGAGAACAAAGCCAGGG + Intergenic
1199991369 X:152989436-152989458 AACAGCAGTGAGCAGAGCCCGGG + Exonic
1201145187 Y:11060698-11060720 AGCTGTAGAGAGGAAAGCTCAGG + Intergenic
1201567162 Y:15377763-15377785 ATCCCCAGAAAGAAAAGCCCAGG + Intergenic