ID: 1034470336

View in Genome Browser
Species Human (GRCh38)
Location 7:151251507-151251529
Sequence GCGGCGCCAGTGTGGGGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034470331_1034470336 -10 Left 1034470331 7:151251494-151251516 CCAGAAAGCTGGGGCGGCGCCAG No data
Right 1034470336 7:151251507-151251529 GCGGCGCCAGTGTGGGGGCCCGG No data
1034470329_1034470336 -2 Left 1034470329 7:151251486-151251508 CCTTCAGACCAGAAAGCTGGGGC No data
Right 1034470336 7:151251507-151251529 GCGGCGCCAGTGTGGGGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034470336 Original CRISPR GCGGCGCCAGTGTGGGGGCC CGG Intronic