ID: 1034471806

View in Genome Browser
Species Human (GRCh38)
Location 7:151258744-151258766
Sequence CAGGGCAGAGAGAAGGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 957
Summary {0: 1, 1: 1, 2: 12, 3: 92, 4: 851}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034471806_1034471816 4 Left 1034471806 7:151258744-151258766 CCCGCCACCTTCTCTCTGCCCTG 0: 1
1: 1
2: 12
3: 92
4: 851
Right 1034471816 7:151258771-151258793 CTGGGCTCCCTGTGGTGCTTTGG No data
1034471806_1034471820 30 Left 1034471806 7:151258744-151258766 CCCGCCACCTTCTCTCTGCCCTG 0: 1
1: 1
2: 12
3: 92
4: 851
Right 1034471820 7:151258797-151258819 CTCCAGGTCCGTGCCAGCCCAGG No data
1034471806_1034471819 14 Left 1034471806 7:151258744-151258766 CCCGCCACCTTCTCTCTGCCCTG 0: 1
1: 1
2: 12
3: 92
4: 851
Right 1034471819 7:151258781-151258803 TGTGGTGCTTTGGAAACTCCAGG 0: 1
1: 0
2: 0
3: 15
4: 187
1034471806_1034471815 -4 Left 1034471806 7:151258744-151258766 CCCGCCACCTTCTCTCTGCCCTG 0: 1
1: 1
2: 12
3: 92
4: 851
Right 1034471815 7:151258763-151258785 CCTGGCTTCTGGGCTCCCTGTGG 0: 1
1: 0
2: 9
3: 73
4: 559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034471806 Original CRISPR CAGGGCAGAGAGAAGGTGGC GGG (reversed) Intronic
900177002 1:1295395-1295417 CAGGGCAGGGCCAAGGAGGCTGG - Intronic
900211182 1:1456578-1456600 CAGGGCAGAAGGGAGGTGGGTGG + Intronic
900217007 1:1486897-1486919 CAGGGCAGAAGGGAGGTGGGTGG + Intronic
900224090 1:1524626-1524648 CAGGGCAGAAGGGAGGTGGGTGG + Intronic
900425452 1:2576324-2576346 CAGGGCAGAGAGAGGGCGCTTGG + Intergenic
900608740 1:3535586-3535608 GAGGGCAGAGGGGAGGTGGGCGG - Intronic
900619388 1:3580038-3580060 TAGGACAGAGAGAACGGGGCTGG - Intronic
900623260 1:3596850-3596872 TAGAGCAGAGGGAAGGTGGGAGG + Intronic
900767609 1:4515609-4515631 CAGGGCAGAGAGCTGGGGTCTGG - Intergenic
901061337 1:6473357-6473379 CTGGGCAGAGAGCAGCTGGAGGG + Exonic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902052902 1:13578217-13578239 GAGGACAGAGAGAGGGTGACTGG + Intergenic
902414058 1:16228617-16228639 CTGGTCAGAGAGCAGGTGGAGGG - Intergenic
902446523 1:16469025-16469047 CAGGGGAGAGGGCAGGGGGCAGG + Intergenic
902447642 1:16477078-16477100 CAGGACAGAGGGCAGGTGGGTGG + Intergenic
902622116 1:17656649-17656671 CAGGCCAGCGAGCAGGTGGAAGG - Exonic
902659245 1:17889980-17890002 CTGGGCAGAAAGAAGTGGGCTGG + Intergenic
902916488 1:19643191-19643213 CCGGGCAGAGGGAAGGGCGCAGG + Intronic
902955352 1:19921459-19921481 CAGGGCTGAGGGGAGGAGGCAGG - Intronic
903049217 1:20588596-20588618 TAGGGCAAAGAGAAGTTGGAAGG + Intergenic
903353259 1:22730817-22730839 CAGGGCTTTGAGGAGGTGGCAGG + Intronic
903657081 1:24956098-24956120 CAGGGCAGAGCCAAGGAGGCAGG + Intronic
904052425 1:27647768-27647790 CAGGGCCGGGAGAAGGAGGAGGG + Intergenic
905173834 1:36124612-36124634 AATGGCAGAGAGATGGGGGCAGG + Intronic
905407037 1:37740802-37740824 CAGGGCTCAGAAAAGGTGTCTGG + Intronic
905448928 1:38045111-38045133 GGGGGCAGAGAGCAGGCGGCGGG + Exonic
905906634 1:41622778-41622800 CAGGGGAAAGGGAAGGTGGCTGG + Intronic
906460209 1:46030841-46030863 CAGGGAGGAGTGCAGGTGGCAGG + Intronic
906478940 1:46187873-46187895 CAGGGCAGAGAGCAGGCAGGAGG + Intergenic
907307415 1:53521046-53521068 AAGGACTGAGAGAAGGAGGCAGG + Intronic
907357856 1:53891127-53891149 AAGGGGAGAGAGAAGGAGGGGGG + Intergenic
907393733 1:54175442-54175464 AAGGGCAGAGAGAAGGATCCTGG - Intronic
907467257 1:54646808-54646830 CAGGACAGAGAGAGGTTGCCAGG - Intronic
907666328 1:56436525-56436547 CTGGGCACAGAGTAGGTGCCAGG - Intergenic
907797186 1:57729401-57729423 CAGTGCAGAGAGGATGTGGCGGG - Intronic
907864836 1:58389766-58389788 CAGGGGAGAGAGGAGAGGGCAGG + Intronic
907934211 1:59027718-59027740 CAGGGGAGAGACTAGATGGCAGG - Intergenic
908007171 1:59738945-59738967 AAAGGCAGAGAGAATGTGCCTGG - Intronic
908824183 1:68117507-68117529 CAGTGCAGAGGAAAGGTGTCTGG - Intronic
909036968 1:70604404-70604426 CAGGGCACAGGGATGGTGGAGGG - Intergenic
909532677 1:76699350-76699372 AAGGGCTGAGAGGAGGTGGAAGG + Intergenic
909600491 1:77456527-77456549 CTGGGCAGAGAGCATGTGCCAGG + Intronic
909632598 1:77782830-77782852 CGGGGGTGAGAGTAGGTGGCAGG - Intronic
912393573 1:109322005-109322027 CAAGGCAGAGAGATGGTGGTTGG - Intronic
912497596 1:110101559-110101581 CAGGGCAGAGCGAGGGTGAAAGG - Intergenic
912579556 1:110707799-110707821 CAGAGAAGAGAAAAGGAGGCAGG - Intergenic
913049404 1:115103814-115103836 CAGGGCAGAGAGAATACTGCAGG + Intergenic
914087365 1:144465223-144465245 AAGGGCAAAGAGAAGGTAGGAGG + Intergenic
914224362 1:145707863-145707885 CAGGGCAGAGGGAAGCAGGATGG - Intronic
914311246 1:146468980-146469002 AAGGGCAAAGAGAAGGTAGGAGG - Intergenic
915047273 1:153028790-153028812 CAGGGCAGAGAGAATTTGTAGGG + Intergenic
915054395 1:153112676-153112698 CGGGGCACACAGGAGGTGGCTGG + Exonic
915099382 1:153487946-153487968 CATGGCAGAGAGAACTTGACTGG - Intergenic
915230006 1:154438599-154438621 CAGGGCTGGGAGAAAGTGGCAGG - Intronic
915244701 1:154548172-154548194 CAGGGCAGTGGAAGGGTGGCTGG - Intergenic
915300855 1:154950897-154950919 CTGGGCAGAGGGAAGATGGTTGG - Intronic
915465929 1:156097893-156097915 CAGGGCAGAGAGAAAACGGTGGG - Intronic
915675231 1:157523725-157523747 CAGGGCAGAGAGTGGGGAGCAGG - Intronic
916078306 1:161216020-161216042 CAGGGTTGATAGAAAGTGGCAGG + Intronic
916861309 1:168808395-168808417 CAGTTCAGAGAGAAGATGGAGGG - Intergenic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
918187138 1:182137980-182138002 TAGGGCACAGAGAGGGTGGCAGG - Intergenic
918187211 1:182138670-182138692 TAGGGCACAGAGAAGGTGGCAGG + Intergenic
919515317 1:198515012-198515034 GAGGAAAGAGAGTAGGTGGCCGG + Intergenic
919614183 1:199784978-199785000 GAGGCTAGAGAGAAGGTGGGAGG - Intergenic
919741046 1:200981824-200981846 TAGGGGAGCGAGAAGGAGGCTGG + Intronic
919819336 1:201463099-201463121 AAGGGCAGAGGGCAGGTGGAGGG - Intergenic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920086213 1:203419308-203419330 CAAGGCAGGGAGAAGGGGGAGGG + Intergenic
920497325 1:206464572-206464594 GTGGGGAGGGAGAAGGTGGCTGG - Intergenic
920580430 1:207101897-207101919 TTGGTGAGAGAGAAGGTGGCTGG + Intergenic
921315763 1:213888596-213888618 GAGGGGAGAGAGAAGGTGGGAGG + Intergenic
921778584 1:219132796-219132818 CAGGGAAGAAAGAAGGTGACTGG + Intergenic
922232138 1:223696661-223696683 CAGAGAAGAGAGCAGGTGCCGGG - Intergenic
922339650 1:224645218-224645240 CAGGGCAGTGGGGAGGTGGTGGG - Intronic
922360016 1:224812594-224812616 CAGGGCAGAGTCAGGGTTGCAGG - Intergenic
922615852 1:226960843-226960865 CTGGGCAGAGCAATGGTGGCTGG + Intronic
922718974 1:227890705-227890727 CAGGGCAGAAAGAAGAGGGTGGG + Intergenic
922807246 1:228396860-228396882 CAGGGCACAGAACACGTGGCTGG + Intronic
922994267 1:229943693-229943715 CCGGACAGAGAGAAGGTGGGAGG + Intergenic
922998634 1:229987241-229987263 CAGGGCAGAAAGAAAGGAGCTGG + Intergenic
923367976 1:233282205-233282227 CAGGGCAAAGAGGAGGCGTCGGG - Intronic
923394476 1:233547408-233547430 CAGTGCAGGGAGAAGGTGTCTGG - Intergenic
923765473 1:236889098-236889120 CAGAGCAGTGAGGAGCTGGCAGG + Intronic
1063112113 10:3046549-3046571 CAGGTGAGAGAGCAGGTGGGAGG - Intergenic
1063112119 10:3046587-3046609 CAGGTGAGAGAGCAGGTGGGGGG - Intergenic
1063112127 10:3046625-3046647 CAGGTGAGAGAGCAGGTGGGGGG - Intergenic
1063112338 10:3047897-3047919 GAGGGGAGAGAGAAGCAGGCAGG - Intergenic
1063675590 10:8138515-8138537 CAGGGGACAGAGAAGGGGCCTGG - Intergenic
1063937025 10:11088753-11088775 CAGGGCACAGAGATGGTGGATGG + Intronic
1063985910 10:11501678-11501700 GAGACCAGTGAGAAGGTGGCAGG - Intronic
1064280684 10:13948591-13948613 CTGAGCAGAGAGCAGGTGGTGGG + Intronic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1067278088 10:44851978-44852000 CAGGGCAGGGAGAATGCAGCCGG + Intergenic
1068700983 10:60019228-60019250 TAGGGCAGAGATATGGTGGGGGG + Intergenic
1068829067 10:61472363-61472385 CAGGTCAGAGAGGAGGTGAGGGG - Intergenic
1069489367 10:68848237-68848259 CAGGGCAGAGGCAAGGAGCCTGG + Intronic
1069606140 10:69739960-69739982 CAGGGCAGGAAGAACGGGGCAGG - Intergenic
1069679968 10:70277451-70277473 CAGGGCACAGAGACTCTGGCAGG + Intronic
1069694661 10:70377670-70377692 AAGGGCAGAGAGAAGGGGCATGG + Intronic
1069821335 10:71230534-71230556 GAGGGCAGAGAGAAGGTGGCTGG - Intronic
1069870030 10:71527443-71527465 CAGGGCCCAGAGGAGGAGGCTGG - Intronic
1069944186 10:71974693-71974715 GAGGGCAGACAGCAGGTGGGCGG - Intronic
1070290321 10:75109573-75109595 CAGGGTGCAGAGGAGGTGGCTGG + Intronic
1070344634 10:75529971-75529993 CAGCTCAGAGAGATGGTGGAAGG + Intronic
1070587172 10:77775130-77775152 CCAGGCAGACATAAGGTGGCTGG + Intergenic
1070723403 10:78772205-78772227 GAGGGCAGAGACAAGGGGTCAGG - Intergenic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1072710803 10:97714497-97714519 GAGGGCAGGGAGAGGGTGCCAGG - Exonic
1072875660 10:99170358-99170380 CAGGCCAGAGAGGAGGGAGCTGG - Intronic
1073082562 10:100869150-100869172 GTGGGCAGAGAGAAGGCAGCAGG - Intergenic
1073119205 10:101111310-101111332 CAGGTTTGAGAGAAGGTGGGAGG + Intronic
1073530064 10:104222593-104222615 GAGGGGAGAGACAAGGGGGCAGG - Intronic
1074721312 10:116267619-116267641 CAGGGCAGACAGTAGGTAACAGG + Intronic
1074850248 10:117433673-117433695 CAGGAAAGAGCAAAGGTGGCTGG - Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1075304296 10:121354309-121354331 CAGGGAGGAGAGAAGAGGGCAGG - Intergenic
1075532553 10:123242010-123242032 CAGGGCAGGAAGGAGGTGCCAGG - Intergenic
1075602596 10:123781355-123781377 CAGGGCAGAGAGGAGAGGACAGG + Intronic
1075724602 10:124604904-124604926 CAGGGTAGAGAGGAGGCGGGTGG + Intronic
1075726554 10:124613542-124613564 CAGGGCAGAGGGCAGAAGGCAGG - Exonic
1075737074 10:124670530-124670552 CAGGGCACAGTGAAGCTGGGGGG - Intronic
1075901915 10:126049973-126049995 CAGGGCAGAAAGGAGGTGGCTGG + Intronic
1075914788 10:126157881-126157903 CAAGGCAGTGGGAAGGTGACAGG + Intronic
1075937183 10:126352201-126352223 AAGGGCAGAGAGCCAGTGGCTGG - Intronic
1076031905 10:127166412-127166434 CAGGGGAGAGAGAAGATGAGTGG + Intronic
1076092037 10:127694744-127694766 CAAGGCTGAGAGATGGAGGCGGG - Intergenic
1076165655 10:128280514-128280536 CAGAGAAGTGAGAAGGTGGGAGG - Intergenic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1076478607 10:130769407-130769429 CTGGGCAGGGTGCAGGTGGCTGG - Intergenic
1076512402 10:131022042-131022064 CATGGTGGAGAGAAGGTGGCTGG + Intergenic
1076618538 10:131772167-131772189 CAGGCCTGAGTGAAGGAGGCTGG + Intergenic
1076642256 10:131926820-131926842 CTGGGCAGAGGCAAGGTGCCGGG - Intronic
1076847261 10:133075419-133075441 GAGGGCAGAGTGGCGGTGGCAGG + Intronic
1076921693 10:133457636-133457658 GAGGGCAGGGAGAAGGGGGGTGG + Intergenic
1078138342 11:8671445-8671467 CAAGGCAGAGAGAGAATGGCTGG - Intronic
1078577232 11:12512849-12512871 GAGGGCACAGAGAAGAGGGCTGG - Intronic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078670646 11:13362041-13362063 CAGGCAAGAGAGAAGGGGCCTGG + Intronic
1079079137 11:17401828-17401850 CAGGGTAGTGAGACGATGGCAGG + Intronic
1079112092 11:17610684-17610706 CAGGCCAGAGAGGAGCTGGGAGG - Exonic
1079357715 11:19743779-19743801 CAGGACAGTGAGAAGCTGCCGGG - Intronic
1079601425 11:22316346-22316368 CAGGGGAGAGAGAGAGAGGCGGG - Intergenic
1079601533 11:22316748-22316770 CAGGGGAGAGAGAGAGAGGCAGG - Intergenic
1080384274 11:31801476-31801498 CAGTGGAGAGAGAGGGTGGGAGG + Intronic
1080552246 11:33382809-33382831 CAGGGCAGGGAGAGGGTGCCAGG - Intergenic
1080603933 11:33848303-33848325 CAGAGCAGGAGGAAGGTGGCGGG - Intergenic
1080822159 11:35817841-35817863 CAGAGCAGAAGGAAGGTGGGGGG - Exonic
1081565766 11:44260157-44260179 CAGGGAAGCTAGAAGGGGGCAGG - Intergenic
1081588961 11:44407657-44407679 CAGGGCAGAGAGAAAGGAGCTGG - Intergenic
1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG + Intergenic
1081872537 11:46390079-46390101 CAGGGCCGAGAGTGGGTGACCGG + Intergenic
1081905885 11:46669605-46669627 CAGGGAAGATAGAAGGTGGTAGG - Intronic
1082160943 11:48886831-48886853 GAGGGCGGAGAGAGGGTGGGGGG + Intergenic
1082161423 11:48893575-48893597 GAGGGCGGAGAGAGGGTGGGGGG - Intergenic
1082849575 11:57753290-57753312 GAGGGCTGAGGGAAGATGGCTGG + Intronic
1083012909 11:59421213-59421235 GAGAGGAGAGAGAAAGTGGCAGG + Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083172874 11:60933513-60933535 AAGGGCAGAGGGCAGGTGGGCGG - Intronic
1083266751 11:61550439-61550461 GAGGGCAGGGGGAGGGTGGCTGG + Intronic
1083268085 11:61556249-61556271 CTGGGCTGAGGGAGGGTGGCAGG - Intronic
1083469667 11:62875223-62875245 AAAGGCAGAGAGAAGATGGGAGG - Intronic
1083643395 11:64157982-64158004 GTGGGCAGAGACAAGGGGGCAGG - Intronic
1083670080 11:64294887-64294909 CAGGGCAGAGAGAGGGAGGGAGG + Intronic
1083890929 11:65595485-65595507 CAGGGCTGAGGGAAGGTCCCAGG + Exonic
1083989851 11:66240300-66240322 GGGGGCAGAGAGAGGGTGGAGGG + Intronic
1084018770 11:66404378-66404400 GAAGGCAAAGAGAAGGTGGAGGG + Intergenic
1084490039 11:69473236-69473258 GAGGGCAGAGACACTGTGGCAGG + Intergenic
1084900660 11:72307666-72307688 CATGGCAGATAGAGGGTGGGAGG + Intronic
1084927467 11:72525013-72525035 CAGGGGAGAGAGAAGCTGTGAGG - Intergenic
1085126145 11:74003976-74003998 AAAGGCAGAGACAAAGTGGCAGG + Exonic
1085388091 11:76168547-76168569 GGGGGCAGAGACAATGTGGCTGG - Intergenic
1085645389 11:78219164-78219186 CAGAGTAGAGAGGAGGTGGATGG + Exonic
1085829413 11:79883809-79883831 AGGTGCAGCGAGAAGGTGGCTGG + Intergenic
1086200206 11:84193359-84193381 CAGGACAGAGAGAAGATGCCTGG + Intronic
1087687846 11:101285568-101285590 CAGTATAGAGAGAAGTTGGCTGG - Intergenic
1088750686 11:112839860-112839882 CCAGGCAGTGAGAAGGTGGGGGG + Intergenic
1089229678 11:116961370-116961392 CAAGTCAGACAGCAGGTGGCTGG + Intronic
1089253026 11:117178942-117178964 CAGGGCCGTGAGAAGGAGGGCGG - Exonic
1089333707 11:117708082-117708104 TAGGGCACAGAGAGGGAGGCAGG - Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089668359 11:120034510-120034532 ATGGGGAGAGAGAAGGAGGCAGG - Intergenic
1089748328 11:120632587-120632609 AAGAGCAGGAAGAAGGTGGCTGG - Intronic
1089949269 11:122510190-122510212 CAAGGCAGAGACACAGTGGCTGG - Intergenic
1089965892 11:122655098-122655120 CAGGGCAGAAAGAAGAGGGAAGG - Intergenic
1089982230 11:122781673-122781695 CAGGGCAAAGACATGGTGGCCGG - Intronic
1090456630 11:126855818-126855840 GAGGGCATAGAGATGGTGGTGGG - Intronic
1090867186 11:130711433-130711455 CAGGGAAGAGTGAGGTTGGCTGG + Intronic
1090902562 11:131045880-131045902 CAGGGAAGGAAGGAGGTGGCGGG + Intergenic
1091284942 11:134403291-134403313 CAGGGATGAGAGCAGGAGGCTGG + Intronic
1091795077 12:3293518-3293540 CAGGGCACATAGGAGGTGGTGGG + Intergenic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092961135 12:13597894-13597916 AAGGGCAGAGAGAAATAGGCAGG + Intronic
1094353302 12:29550467-29550489 CAGAGGAGCGAGGAGGTGGCAGG + Intronic
1095195027 12:39304272-39304294 CAAGGTAGAGAGAAGTTGACTGG - Intronic
1096077737 12:48815533-48815555 CAGGGGAGAGGGAAGGGAGCAGG + Intronic
1096404660 12:51334765-51334787 GAGGAGAGAGAGAAGCTGGCAGG - Intronic
1096445229 12:51683993-51684015 CAGGGCAGAGGGAGGGAGGTGGG + Intronic
1096521576 12:52187488-52187510 CAGAGCAGAGAGAGAGGGGCTGG - Intronic
1096677235 12:53232322-53232344 CAGGGCACAGAGGAGGGAGCCGG - Intronic
1096806734 12:54145522-54145544 CAGGGGAGAGGAATGGTGGCTGG + Intergenic
1096809813 12:54162078-54162100 CATGGCAAAGAGAAGGGAGCAGG + Intergenic
1096845268 12:54403157-54403179 CAGGGCAGGGAGAAGGGACCTGG - Intronic
1097182168 12:57177758-57177780 CAGGGCCGAGGGGAGGGGGCAGG + Intronic
1097606697 12:61763796-61763818 GAGGTCAGAGAGAAGGGAGCAGG + Intronic
1097841523 12:64326207-64326229 CAGGGTAGAGAGGAGGGGGGTGG + Intronic
1098807395 12:75036698-75036720 CAGGCAAGAAAGAACGTGGCTGG + Intergenic
1099195710 12:79613088-79613110 CATGGCAGAGAGAAAGAGGGAGG - Intronic
1099351863 12:81581316-81581338 CAAGGCAGAGAAAATGTGGCTGG - Intronic
1100289694 12:93202013-93202035 CAGGGAAGAACGAAGGTGGCTGG - Intergenic
1100423082 12:94456718-94456740 CAGGGAAGAGACCAGGTGGAGGG - Intronic
1101405762 12:104427313-104427335 CAGAGCAGAGAGACGGAGTCTGG + Intergenic
1101594226 12:106149471-106149493 CAGGGCAGGGAGAAGGAAGGCGG + Intergenic
1101760172 12:107651866-107651888 CAGGGCAGAGAGTGGGTGCTGGG + Intronic
1101836833 12:108301834-108301856 CAGGGCAGAGAGGTGGAGGCTGG - Intronic
1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG + Intergenic
1102574715 12:113849138-113849160 CAGGGCACAGGGAGGGTGCCTGG - Intronic
1103209793 12:119157781-119157803 CTGGGCAGAGGGGAGGGGGCTGG - Exonic
1103283415 12:119779699-119779721 CAGGGAAGAGAGATGTTGGGGGG - Intronic
1103844595 12:123892623-123892645 CAGGGAAGAGTTAACGTGGCAGG - Intronic
1104092125 12:125526077-125526099 CAGAGCAGAGACAGGGTGGGAGG + Intronic
1104748037 12:131221992-131222014 CAGGGCTGGGGGAAGGTGGAGGG + Intergenic
1104900047 12:132184737-132184759 CAGGGTGGAGAGAAGCAGGCTGG - Intergenic
1104906491 12:132215995-132216017 GAGGGAAGGGAGACGGTGGCGGG + Intronic
1104971726 12:132533861-132533883 CAGGTCGGAAGGAAGGTGGCCGG + Intronic
1105069895 12:133227919-133227941 CTGGGCAGAGGGAGGGGGGCGGG + Exonic
1105637349 13:22228228-22228250 CAGGGCAGAGAGATGCTCCCTGG - Intergenic
1105948353 13:25208668-25208690 AAGGGAAGGAAGAAGGTGGCGGG + Intergenic
1106174797 13:27321014-27321036 CAGGGCTGAGAGCAGGAGGCTGG + Intergenic
1106762939 13:32884923-32884945 CATGGCAGAGAGAAGAAAGCTGG + Intergenic
1106788297 13:33129358-33129380 CTGGGCAGAGAGCAGGTCCCTGG - Exonic
1109158862 13:58947340-58947362 CTGGGCAGAGATAAGGAGGGTGG - Intergenic
1109284591 13:60396534-60396556 CAGTACAGAGCCAAGGTGGCAGG + Intronic
1109585643 13:64398890-64398912 AAGGGAAGAGGGAAGGTGGGGGG + Intergenic
1109697946 13:65985493-65985515 GAGGGCAGAGAGAAGCTGCTGGG + Intergenic
1109716166 13:66225359-66225381 CAAGGCAGAGAGAGGGTGGAGGG - Intergenic
1109889064 13:68583122-68583144 TTGGGCACAGAGGAGGTGGCAGG - Intergenic
1111394677 13:87649757-87649779 CTGGGCATAGATAAGGTGGATGG - Intergenic
1111927877 13:94482473-94482495 TGTGGTAGAGAGAAGGTGGCTGG - Intergenic
1112524305 13:100129532-100129554 CTGGTCAGGGAGAAGGTGGGAGG - Intronic
1112901725 13:104365180-104365202 CAGGGGAGATAGGATGTGGCTGG - Intergenic
1113109581 13:106807896-106807918 AAGGGCAGAGAGTAGGTGAAGGG - Intergenic
1113285636 13:108845461-108845483 CAGGGCGGACAGCAGGAGGCAGG + Intronic
1113673922 13:112195566-112195588 CAGGGCAGAGAGACTGTGAAAGG - Intergenic
1113754848 13:112804017-112804039 GAGGGCAGAGAGGGGATGGCAGG - Intronic
1113754905 13:112804174-112804196 GAGGGCAGAGAGGGGATGGCAGG - Intronic
1113842682 13:113369357-113369379 CAGGGCAAAGGGAAGGCGGGAGG - Intergenic
1113972450 13:114200302-114200324 CTGGGGACAGAGAAGGAGGCTGG - Intergenic
1114260751 14:21034466-21034488 CAGGGCTGGCTGAAGGTGGCTGG - Intronic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1114719448 14:24864927-24864949 CAGTAGAGAGAGAAGGTGGCGGG - Intronic
1115922722 14:38394484-38394506 CAGTGGAGAGAAGAGGTGGCAGG + Intergenic
1117076861 14:52113948-52113970 CAGTGCAGAGAGAATTTGGAGGG - Intergenic
1117206623 14:53450075-53450097 CAGGGCAAAGAGGAGATGGATGG + Intergenic
1117899523 14:60517334-60517356 CAGAGGAGAGAAAAGGTGGGAGG - Intergenic
1118137098 14:63042142-63042164 CAGAGCAGAGAGAAAGGGGTGGG - Intronic
1118251936 14:64170383-64170405 CACTGCAGATAGCAGGTGGCTGG - Exonic
1118769455 14:68932281-68932303 CACGGGAGAGAGATGGAGGCTGG - Intronic
1118964869 14:70571390-70571412 AAGTGCAGAGAGAAGGTGGCGGG - Intergenic
1119318882 14:73717912-73717934 CAGAGCAGAGGCAAGGAGGCTGG + Exonic
1119429358 14:74555759-74555781 AAAGGCAGAGAGTGGGTGGCTGG - Intronic
1119759002 14:77138591-77138613 CAGAGCAGAGGGAACGTGGGTGG - Intronic
1119783653 14:77296404-77296426 CATGGGAGTGAGAAGGTAGCTGG - Intronic
1121003090 14:90465976-90465998 CAGGGGAGAGAGAGGGAGACTGG + Intergenic
1121095948 14:91218094-91218116 CAGGGAAGAGAGATGGGGGAGGG + Intronic
1121229126 14:92343469-92343491 GGAGGCAGAGAGAAGCTGGCTGG - Intronic
1121260008 14:92559161-92559183 CAAGGAAGAGAGAAGGGGGCCGG - Intronic
1121274320 14:92657491-92657513 CAGACCAGAGAGGAGGTGCCAGG + Intronic
1121322324 14:92999276-92999298 CACAGCACAGAGAGGGTGGCAGG + Intronic
1121413300 14:93762454-93762476 CAGGGCACAGAGAAGATAGCTGG - Intronic
1121688589 14:95858104-95858126 GAGAGCAGGGAGAAGGTGGGTGG + Intergenic
1121826170 14:97011302-97011324 CAGGGCAGAGTGGCAGTGGCAGG + Intergenic
1121950031 14:98163628-98163650 CAGGGCAGGGAGGAGGGGACAGG - Intergenic
1122148175 14:99706538-99706560 CTGTGCAGAGTGAAGGTGGGTGG - Intronic
1122227336 14:100287365-100287387 AAGGGCAGAGAGAAGGGGGCAGG - Intergenic
1122388108 14:101362610-101362632 CAGGTCGGGGAGAAGGTGGCCGG - Intergenic
1122476031 14:102009660-102009682 CTGGGCTGGGAGAATGTGGCTGG + Intronic
1122595606 14:102888332-102888354 CAGGGCAGAGTCAAGGTGGTAGG - Intronic
1122662762 14:103309093-103309115 CTGGGCAAAGCGAGGGTGGCTGG + Intergenic
1122717879 14:103706255-103706277 CAGGCCCGTGAGGAGGTGGCTGG + Intronic
1122848778 14:104515384-104515406 AAGGGCAGAGAGAAGTGGGTGGG + Intronic
1123023621 14:105413365-105413387 CAGGGCAGAGCGGAGCTGACAGG + Exonic
1123113134 14:105882242-105882264 CAGGGTGGAGAGGAGGTGGGCGG + Intergenic
1123115480 14:105892392-105892414 CAGGGTGGAGAGGAGGTGGGCGG + Intergenic
1202852408 14_GL000225v1_random:30010-30032 AAGGGCAGAGAGAGGCTGGAGGG - Intergenic
1124036138 15:26054918-26054940 CAGGGCAGAGGGCAGCAGGCAGG + Intergenic
1124108978 15:26769741-26769763 GAGGGACGAGAGAAGCTGGCTGG - Intronic
1124263689 15:28214624-28214646 CAGGGCACAGGGAAGGTAGACGG + Intronic
1124431818 15:29614735-29614757 CTGGGAAGGTAGAAGGTGGCAGG + Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125370911 15:38975351-38975373 AAGGACAGAGAGGTGGTGGCTGG - Intergenic
1127392669 15:58519609-58519631 CAAGGCAGAGAGAACCTGGAAGG - Intronic
1127397207 15:58552446-58552468 GAGGGCAGAGAGGAGGAGGCGGG - Intronic
1127482665 15:59391673-59391695 CAGGGCAGCCAGAAGGTAGGGGG + Intronic
1127724663 15:61737308-61737330 CAGCCCAGAGAGAGGGAGGCTGG - Intergenic
1128233207 15:66049693-66049715 CAGAGCAGAGAGAGGGTGTAAGG - Intronic
1128311276 15:66632979-66633001 CAGGGCAGAGCGAAGGTCTGGGG - Intronic
1128348914 15:66876261-66876283 CAGGGCAGAGACCAGGTTGTGGG - Intergenic
1128630257 15:69258139-69258161 GAGGGTAGAGGGTAGGTGGCGGG - Intronic
1129165434 15:73774591-73774613 CAGGGGTGAGAGGAGGTGGACGG - Intergenic
1129170209 15:73802978-73803000 GTTGGCTGAGAGAAGGTGGCCGG + Intergenic
1129170939 15:73807460-73807482 CAGGGCAGAGGGAACATGGGAGG - Intergenic
1129329961 15:74821966-74821988 CAGGGCAGAGAGGACTGGGCTGG + Intronic
1129386706 15:75200472-75200494 CAGGGCAGGGACAGGGTCGCCGG + Intronic
1129778941 15:78256518-78256540 CAGGGTAGAGTGAACGTGGAAGG - Intergenic
1130907059 15:88248101-88248123 CAGCCCAGAGAGGAGCTGGCTGG + Intronic
1131067033 15:89441260-89441282 GAGGGGAGTGAGAGGGTGGCAGG + Intergenic
1131078351 15:89513370-89513392 CAGTCCAGAGAGGAGGTGACTGG - Intergenic
1131313252 15:91309792-91309814 TTGGGCAGAGAGAAGTTGGGTGG - Intergenic
1131821994 15:96283133-96283155 AAGGGCAGAGAGAAGTTCACTGG + Intergenic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1132106490 15:99066604-99066626 CAGGGCTGAGAGAAGGACCCAGG - Intergenic
1132203127 15:99968762-99968784 GCTGGCAGAGAGCAGGTGGCAGG + Intergenic
1132224407 15:100129257-100129279 AAGTGCAGAGAGAAATTGGCAGG - Intronic
1132347828 15:101119073-101119095 TTGCCCAGAGAGAAGGTGGCAGG - Intergenic
1132567710 16:630928-630950 CAGGGCAGAGGGGAGGAGGTTGG - Exonic
1132602301 16:778763-778785 CTGGGCAGAGAGGAGGAGACAGG + Intronic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1132709487 16:1260060-1260082 CAGGGCAGAGAAGAGGTGGAAGG - Intergenic
1132887116 16:2187132-2187154 CAGGGCAGAGGGGCAGTGGCTGG - Intronic
1133062300 16:3182941-3182963 CAGGGCTGAGAGGCGGAGGCGGG - Intergenic
1133172907 16:3992772-3992794 CAGGGCACAGGCAAGGTGGATGG + Intronic
1133234069 16:4379568-4379590 CAGGGCAGACAGAAGAAAGCAGG - Intronic
1133310010 16:4839132-4839154 AAGGGCGGGGAGAAGATGGCAGG + Intronic
1133818737 16:9217791-9217813 CAGGGCTGAGTGGAGGTGGTTGG - Intergenic
1133865313 16:9636713-9636735 CAGGGGAGAGAGAAAGGGGAGGG + Intergenic
1134093473 16:11403867-11403889 CCGGGCAGGGAGAAGGGGCCAGG - Intronic
1134303563 16:13012648-13012670 CAGGTCACAGAGAAGGAGGTGGG + Intronic
1134581829 16:15377581-15377603 CAGGGCGGAGGGAAGGGGACGGG + Intronic
1135028157 16:19014599-19014621 CAGGGGAAAGAGAAGGTGCTGGG - Intronic
1135183081 16:20291920-20291942 CAGGGGAGAGAGGAGGGGGAGGG + Intergenic
1136016903 16:27406184-27406206 GAGGGGAGAGAGACGGTGGGTGG + Intronic
1136779176 16:32886228-32886250 GAGGGCAGGGACAAGGTGGGCGG - Intergenic
1136891441 16:33975290-33975312 GAGGGCAGGGACAAGGTGGGCGG + Intergenic
1136983721 16:35081709-35081731 CAGGGCACAGAGCAAGAGGCTGG - Intergenic
1137784296 16:51125190-51125212 GAGGGCAGAGGGAAGGTGGGAGG + Intergenic
1138109226 16:54310276-54310298 CAAGCCTGAGAGAAGGAGGCAGG - Intergenic
1138244847 16:55459905-55459927 CAGGGGTGAGAGGAGATGGCTGG - Intronic
1138346198 16:56321731-56321753 CTGGGCAGAGAGGAGCGGGCAGG + Intronic
1138420824 16:56898029-56898051 CAGGGCAGTGAGGAGCTGGCTGG - Intronic
1138445261 16:57059374-57059396 CAGGGCACAGAGAGGGAAGCGGG - Intronic
1138454705 16:57114545-57114567 CAGGGCACAGAGCAGGTGTGTGG + Intronic
1138596386 16:58031416-58031438 CAGGGCAGAGCTTGGGTGGCTGG - Intronic
1139206799 16:65036914-65036936 AAAGGCAGAAAGAAGATGGCAGG + Intronic
1139320419 16:66109730-66109752 AAGGGAAGAGGGAAGGTGGAAGG + Intergenic
1139515381 16:67449622-67449644 CACTGGAGAGAGTAGGTGGCTGG - Intronic
1139635338 16:68255216-68255238 CTGGGCATAGTGTAGGTGGCCGG + Intronic
1139915369 16:70424989-70425011 CAGGGCACAGAGATGGCAGCTGG + Intronic
1140050567 16:71477641-71477663 CAGGCCATTGAGAAGGTGGGTGG - Intronic
1140479221 16:75253475-75253497 CGGTGCAGAGAGGAGGTGGATGG + Intronic
1141103713 16:81216131-81216153 AAGGTCAGAGAGATGGAGGCAGG + Intergenic
1141193627 16:81842884-81842906 GAGGGCTGAGGGAGGGTGGCTGG + Intronic
1141372844 16:83503447-83503469 AGGGGCAGTGAGAAGGAGGCCGG + Intronic
1141647796 16:85376760-85376782 CTGGGCAGAGAGCAGGGGGCTGG + Intergenic
1141675672 16:85515978-85516000 AAGGGCAGAGAGGAGATGGCAGG + Intergenic
1141698516 16:85631976-85631998 CGGAGCAGAGAGCAGCTGGCAGG + Intronic
1141723168 16:85768109-85768131 CTGGGCAGAGGGAAGCAGGCAGG - Intergenic
1141727555 16:85799750-85799772 CAGGTGAGACAGGAGGTGGCCGG + Exonic
1142581988 17:948880-948902 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142581996 17:948899-948921 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142582004 17:948918-948940 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142582012 17:948937-948959 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142666170 17:1465126-1465148 TAAGGCAGAAAGAAGGGGGCAGG + Exonic
1142732607 17:1871437-1871459 GAAGGCAGAGACAGGGTGGCAGG + Intronic
1142748453 17:1972871-1972893 CAGGCCAGAGAGAGCCTGGCTGG + Intronic
1142957174 17:3529981-3530003 AAGGGCAGGGAGAAGAGGGCTGG - Intronic
1143097130 17:4484135-4484157 CAGGGCTGAGAGAGGATTGCAGG - Intronic
1143185519 17:5007685-5007707 CAAGACGGAGAGGAGGTGGCAGG - Intronic
1143325143 17:6093674-6093696 CAGGGCAGACACACGGTGGTGGG + Intronic
1143365452 17:6405618-6405640 GTGGGCAGAGGGAAGGAGGCCGG - Intronic
1143593998 17:7903246-7903268 CAGGGGCAAGAGAAAGTGGCGGG - Intronic
1143902455 17:10184349-10184371 GAGGACAGAGATATGGTGGCTGG - Intronic
1144155216 17:12493821-12493843 CACGGGAGAAAGAAGGAGGCCGG - Intergenic
1144356412 17:14451120-14451142 CAGGGCAGAGACCAAGTGACAGG + Intergenic
1144422846 17:15113855-15113877 CAGGGAAGAGATGAGGAGGCTGG + Intergenic
1144435277 17:15234395-15234417 GAAGTCAGAGAGAAGTTGGCTGG + Intronic
1144833280 17:18143568-18143590 GAGGGCAGAGTGGAGGTGCCAGG + Exonic
1145124018 17:20285766-20285788 AAGGGGAGAGAGAAGGAGGGAGG - Intronic
1145722893 17:27089694-27089716 CAGAGCAGTAAGAGGGTGGCCGG + Intergenic
1145783230 17:27577650-27577672 CAGGCAAGGGAGAGGGTGGCAGG - Intronic
1146671134 17:34738737-34738759 CAGAGCAGAGGGAAGGTTTCAGG - Intergenic
1146798509 17:35800036-35800058 CAGTGCAGAGAGAGGGAGGGAGG - Intronic
1147037381 17:37691872-37691894 CAGGGCACTGACAAGGGGGCAGG - Intronic
1147321100 17:39646689-39646711 CAGGACAAACAGGAGGTGGCTGG - Intronic
1147584503 17:41646167-41646189 AGGGACAGAGAGAAGGAGGCAGG - Intergenic
1147587084 17:41658905-41658927 CAGGGCAGGGAGGGGCTGGCAGG + Intergenic
1147652561 17:42070898-42070920 GAGGGCAGTGGGGAGGTGGCAGG - Intergenic
1147975656 17:44246889-44246911 CAGGGCAAAGAGAGAGTGGCTGG - Intergenic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148615628 17:48997998-48998020 CCGGGAAGAGAGGAGTTGGCGGG - Intronic
1148736149 17:49865967-49865989 CAGGAGGGAGAGAAGGCGGCAGG + Intergenic
1149457397 17:56798972-56798994 CAAGAAAGAGAGAAGGTGCCAGG + Intronic
1149552777 17:57552388-57552410 CAGGGCAGTGAGTGGGGGGCTGG - Intronic
1149611286 17:57959346-57959368 CAGGGCAGAGGAGAGGGGGCAGG - Intergenic
1149677251 17:58477047-58477069 CAGCGCTGGGAGGAGGTGGCTGG - Intronic
1150985846 17:70196225-70196247 ATGGGAAGAGAGAAGGTGGCTGG + Intergenic
1151000350 17:70368907-70368929 CAGGGCAGAGTGAAGGTGGGGGG + Intergenic
1151299914 17:73216523-73216545 CAAGGCAGAGAGGAGGTGAGTGG + Intronic
1151492186 17:74439355-74439377 CAGGGCAGAGAGGAGGTACTGGG + Intronic
1151820151 17:76492759-76492781 CAGGGCAGGGAGAGCGTGACAGG + Intronic
1151826585 17:76527308-76527330 CAGAGGTGAGGGAAGGTGGCAGG + Intergenic
1152228232 17:79102471-79102493 CAGGGCAGCCAAAGGGTGGCTGG - Intronic
1152428018 17:80229144-80229166 CACAGAAGAGAGAGGGTGGCTGG + Intronic
1152592132 17:81218880-81218902 CAGGGCAGAGAGAAGGGGTCTGG - Intronic
1152596976 17:81242559-81242581 AAGGGCAGAGCAAAGGTGGGAGG - Intergenic
1152748037 17:82050202-82050224 CTGGGCAGAGAGGGGGTGTCTGG - Intronic
1152834905 17:82523146-82523168 AAGGGCAGTGAGATGGAGGCTGG + Intronic
1153052941 18:917359-917381 CAGCGAAGAGAGAAAGGGGCAGG - Intergenic
1153054085 18:928328-928350 TGGGGCAGAGGGAAGGTGTCTGG + Intergenic
1153224404 18:2887527-2887549 GAGGGAAGGGAGAAGGTGCCAGG - Intronic
1153646672 18:7202216-7202238 CAGGGCAGAGGGGAGGTTGGAGG + Intergenic
1154389518 18:13924364-13924386 CAGGGCAAAGACAAGATGCCAGG - Intergenic
1154983273 18:21522128-21522150 CAGGGAAGAGGGAATGTGGTTGG + Intronic
1155911905 18:31513686-31513708 CAGGGCAGAGGGAAGCGGGGAGG - Intronic
1156472271 18:37384661-37384683 CAGAGCAAAGTGAAGGTGGTAGG + Intronic
1157285238 18:46373160-46373182 CAGGGCCTAGAGAATGGGGCAGG - Intronic
1157289231 18:46398310-46398332 CAGGGCAGGAAGAAGGAAGCAGG + Intronic
1157439131 18:47696878-47696900 CAGGGCAAAGAGGAGGGGGTGGG - Intergenic
1157439195 18:47697130-47697152 CAGGGCACAGAGAAGAGGGTGGG - Intergenic
1157500918 18:48190095-48190117 CAAGGCAGAGAGAAGAGGGACGG - Intronic
1157600490 18:48890209-48890231 CAGGGCAGAGAGGGGGAGGCCGG - Intergenic
1157804081 18:50645059-50645081 CAGGCCAGGGAGTGGGTGGCTGG + Intronic
1157816654 18:50734414-50734436 GAGGGCAGTGAGGAGGTGACAGG + Intergenic
1159671195 18:71222698-71222720 CAGGCAAGAGAGAATGTGCCAGG + Intergenic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160334016 18:78020827-78020849 CAGCACAGAGAGAATGTAGCTGG - Intergenic
1160344787 18:78123967-78123989 CCTGGCAGAGAGCAGGAGGCAGG - Intergenic
1160355810 18:78227550-78227572 CAGGGCTCAGGGAAAGTGGCAGG - Intergenic
1160396029 18:78572782-78572804 AAGGCCAGAGAGCTGGTGGCAGG + Intergenic
1160773360 19:843686-843708 CCGGGCAGAGGGACAGTGGCCGG - Intronic
1160812351 19:1018268-1018290 CTGGGGAGAGAGGAGGCGGCAGG - Intronic
1161290844 19:3492582-3492604 CAGGGGAGAGAGACACTGGCAGG + Intronic
1161390194 19:4016699-4016721 CCAGGCAGAGAGGAGGGGGCAGG + Intronic
1161498043 19:4598118-4598140 CAGGGCTGAGAGAAAATGGGTGG + Intergenic
1161950221 19:7463678-7463700 CACGGCACACAGAAGGGGGCAGG + Intronic
1161966339 19:7551125-7551147 CGGGGCAGAGAGGCGGAGGCGGG + Intronic
1162183062 19:8883710-8883732 CAGGGCAGAGTGAGGTGGGCAGG + Intronic
1162185149 19:8898881-8898903 CAGGGCAGAGTGAGGAGGGCAGG + Intronic
1162588650 19:11576954-11576976 GAGGGCAGAGGGAAGGTGATGGG - Intronic
1162940259 19:14005349-14005371 CCTCCCAGAGAGAAGGTGGCAGG + Intronic
1163019372 19:14474353-14474375 GAGGGCAGAGTGAGGCTGGCTGG + Intronic
1163388552 19:17015509-17015531 CAGAGCAGACAGGAGGTGGGTGG - Intronic
1163529609 19:17841964-17841986 TCCGGCAGAGAGAAGGAGGCGGG - Intronic
1163575597 19:18109509-18109531 TGGGGCACAGGGAAGGTGGCAGG - Intronic
1163676174 19:18656391-18656413 CAAGGCTCAGAGAGGGTGGCGGG - Intronic
1163749087 19:19064672-19064694 CAGGGCAGAGGGCAGGTGCCAGG - Intronic
1164564303 19:29314921-29314943 CAGGGTGGAGAGGAGGAGGCTGG + Intergenic
1164572613 19:29385266-29385288 CAAGGGAGAGAGGGGGTGGCAGG + Intergenic
1164587441 19:29484866-29484888 CAGGGAAAAGAAAAGGGGGCTGG - Intergenic
1164684055 19:30155677-30155699 CAGGACGGGGAGCAGGTGGCTGG - Intergenic
1165084926 19:33337911-33337933 GAGGAAAGAGAGAAGGAGGCCGG + Intergenic
1166046652 19:40234199-40234221 TGGGGCAGAGAGAAGGTGGGAGG - Intronic
1166069945 19:40381173-40381195 CGGGGCATGGAGAAGGGGGCAGG + Intronic
1166258001 19:41619717-41619739 CAGGGGAGAGAGGAGATGTCAGG + Intronic
1166384436 19:42372471-42372493 GACTGGAGAGAGAAGGTGGCGGG - Intronic
1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG + Intronic
1166785627 19:45365007-45365029 CAGGGCTGAGGGAGGGAGGCAGG - Intronic
1166921059 19:46229534-46229556 CATAGCACAGAGAAGGTGGAGGG + Intergenic
1166972669 19:46580178-46580200 CAGCGTAGAGGGAATGTGGCGGG + Intronic
1167011840 19:46813709-46813731 GAGGTGAGAGAGAAGGAGGCGGG - Intergenic
1167085988 19:47310039-47310061 CAGGAGAGAGGGAAGGTGGGAGG - Intronic
1167720441 19:51176268-51176290 CAGGACAGTGGGGAGGTGGCTGG - Intergenic
1167743327 19:51337573-51337595 GAGGGGAGAGGGAAGGGGGCTGG + Intronic
1167898757 19:52602302-52602324 CAGGGAAGAGAGAATGTAACAGG + Intronic
1167909310 19:52689360-52689382 CAGGGAAGAGAGAATGTAACAGG - Intronic
1167995239 19:53396258-53396280 CAGGGAAGAGAGAATGTAACAGG + Intronic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168323091 19:55521845-55521867 CAGAGCTGGCAGAAGGTGGCAGG - Intergenic
925126699 2:1462054-1462076 TAGGGCAGAGAGACGGTACCTGG - Intronic
925151333 2:1617600-1617622 CAGGGCAGAGGGAAAGTGTGGGG - Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925822656 2:7815581-7815603 GGGGGCAGAGAGGATGTGGCCGG - Intergenic
926109729 2:10174111-10174133 CGTGGCAGAGAGAAGGTGGCAGG - Intronic
926228402 2:10984437-10984459 CTGGGCACTGAGAAGGAGGCAGG - Intergenic
926329827 2:11815213-11815235 CAGGGCAGAGAAGAGGCTGCTGG - Exonic
926542401 2:14197542-14197564 GAGGGCAGAGAGAAGGAGTGAGG - Intergenic
926700468 2:15800044-15800066 CAGGGGAGAGGGCAGGTGCCTGG + Intergenic
926991138 2:18681645-18681667 CAGGGCAGAGCAAAGGAGGTAGG + Intergenic
927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG + Intergenic
927518370 2:23685178-23685200 CAGGGCAGAGGGCAGGAGGGAGG - Intronic
927562615 2:24084477-24084499 CAGGGCAGCGAGGCGCTGGCCGG - Exonic
927932092 2:27051851-27051873 AGGGGCTGAGAGAAGGGGGCGGG - Intronic
928096533 2:28408409-28408431 CAGGCCAGAGAGAAGGAGCTGGG - Intronic
928101510 2:28440108-28440130 GCGGGCAGAGGGAAGGGGGCAGG - Intergenic
928137196 2:28696528-28696550 CATGTCAGATAGAAGGTGGGAGG - Intergenic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
930153929 2:48086113-48086135 CAGGCAAGAGAGCAGGTGGAGGG + Intergenic
930302206 2:49630628-49630650 AAGGGCAGAGAGAAGGGGAAGGG + Intergenic
930752261 2:54945224-54945246 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
930752270 2:54945254-54945276 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
930997443 2:57737503-57737525 CAGAGCAGAAAGAAGGAGACTGG + Intergenic
931455310 2:62405432-62405454 AATGGCAGAGAGCAGGAGGCAGG - Intergenic
931864011 2:66390485-66390507 CAGGGTAGAAAGAGGGGGGCTGG - Intergenic
932307713 2:70715755-70715777 GGGGGCAGAGAGGAGGGGGCTGG - Intronic
932330173 2:70894292-70894314 AAGGGCAGGGAGAGGATGGCTGG - Intergenic
932568777 2:72925644-72925666 CCGGGCAGTGAGAAGATGCCCGG + Intronic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
933513093 2:83265807-83265829 CAGGGGAGAGAGAAAGGGGTGGG - Intergenic
933655419 2:84882547-84882569 CAGCTCAGAGAGAAGCTGGGCGG - Intronic
933807710 2:86012178-86012200 CAGGGCAGAGGGTAGGGGGCGGG - Intergenic
933975341 2:87504835-87504857 CAGGGCAGAGCGGTGGGGGCGGG + Intergenic
934028122 2:88017553-88017575 GCGGGCAGATAGATGGTGGCTGG - Intergenic
934163788 2:89275927-89275949 GAGTGCAGAGAGGAGGAGGCAGG - Intergenic
934203484 2:89906597-89906619 GAGTGCAGAGAGGAGGAGGCAGG + Intergenic
934592002 2:95561993-95562015 CAGTAGAGAGGGAAGGTGGCTGG - Intergenic
934818188 2:97348472-97348494 CAGTGCAGACAGGAGGAGGCAGG + Intergenic
934860966 2:97763356-97763378 AAGGTGAGAGAGAAGGTAGCAGG - Intronic
935148845 2:100416176-100416198 CAGGGGAGAGAGGTGGTTGCAGG - Intronic
935523238 2:104135553-104135575 CAGGAAAGAGAGAAGGCAGCAGG + Intergenic
935544531 2:104386880-104386902 CTGGGCAGTGAGGAGGTGGCTGG - Intergenic
935673381 2:105574121-105574143 CAGAGCAGAGGGAAGGTGGCTGG - Intergenic
936060616 2:109293470-109293492 CAGTGGAGAGAGAAGGGGGCAGG - Intronic
936318485 2:111445978-111446000 CAGGGCAGAGCGGTGGGGGCGGG - Intergenic
936459060 2:112698077-112698099 CAGAGGACAGAGAAGGTGGTAGG - Intergenic
936902979 2:117504847-117504869 AAGGACACCGAGAAGGTGGCTGG + Intergenic
937085077 2:119166232-119166254 CAGGACAGAAAAAAGCTGGCAGG - Intergenic
937213809 2:120297410-120297432 CAGGGTCAAGAGATGGTGGCAGG - Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937710934 2:124979147-124979169 CAGATTAGAGAGAAGGTAGCTGG + Intergenic
937863859 2:126733318-126733340 GAGGGCAGGGAGGAGGGGGCAGG + Intergenic
937901493 2:127022967-127022989 CAGGGCAGATAACTGGTGGCCGG + Intergenic
937989237 2:127653247-127653269 CCGGACAGAGAGAGTGTGGCAGG + Intronic
937993994 2:127679608-127679630 TAGGGAAGGGAGAAGGTGGGGGG - Intronic
938107390 2:128542659-128542681 CAGCCCAGAAAGAAGGAGGCTGG - Intergenic
938366204 2:130736583-130736605 CAGGGGAGAGGGAAAGTGGGAGG - Intergenic
938467391 2:131532647-131532669 CAGGGCAGGCAGATGGGGGCGGG + Exonic
939089073 2:137757691-137757713 CAAGGCAGAGGCAAGGTTGCTGG - Intergenic
939523830 2:143266458-143266480 CAGGGCAGACTAAAGGTGGTTGG + Intronic
940775122 2:157876466-157876488 GAGGGGAGAGAGGAGGCGGCGGG + Intergenic
941736318 2:168980923-168980945 CAGGGTAGAGAGGAGGAGACTGG - Intronic
942218512 2:173746334-173746356 TAGGGCTGAGGGAAGGGGGCAGG + Intergenic
942470197 2:176251926-176251948 AAAGGCAGAGAGAAGGTAGAAGG + Intergenic
944868281 2:203883768-203883790 CTGGGCTGAGGGAAGGAGGCTGG + Intergenic
945350201 2:208768653-208768675 CAGGTAAGAGAGAACTTGGCAGG - Intronic
946030204 2:216697622-216697644 AAGGGTAGAGAGAAGGGGGGAGG + Intergenic
946188111 2:217992666-217992688 CAGGGGAGAGAGAGGGGTGCGGG + Intronic
946220627 2:218222990-218223012 TAGGGCAGGCAGCAGGTGGCAGG - Intronic
946229296 2:218281906-218281928 AAGGGCAGATGGAAGGTGGGTGG - Intronic
946593977 2:221285521-221285543 CAGGGGAGAGAGAAGGGAGTTGG - Intergenic
947082030 2:226409700-226409722 GAAGGCAAAGAGAAGGAGGCAGG + Intergenic
947418397 2:229921465-229921487 CTGGGAAGAGAGAAAGTGGGGGG - Intronic
947769455 2:232659448-232659470 GAGGGCAGGGAGGGGGTGGCTGG + Intronic
947839290 2:233197471-233197493 CAGGGCAGAGAGATGGTGGGGGG - Intronic
948169157 2:235887386-235887408 CAGAGGAGAGAAAAGGAGGCAGG - Intronic
948232105 2:236356236-236356258 CAGGGCGCAGGGAAGGAGGCTGG - Intronic
948232339 2:236359084-236359106 CAGGGCGCAGGGAAGGAGGCTGG + Intronic
948612049 2:239176183-239176205 CCGGGCAGAGGGAGGGAGGCCGG - Intronic
948612078 2:239176267-239176289 CCGGGCAGAGGGAGGGAGGCCGG - Intronic
948612086 2:239176286-239176308 CCGGGCAGAGGGAGGGAGGCCGG - Intronic
948618406 2:239216676-239216698 CAGGGCAGAGTGAAGGCGGAGGG - Intronic
948677581 2:239607835-239607857 GAGGACAGGGAGAAGGTTGCTGG + Intergenic
949076286 2:242060777-242060799 CAGAGCAGAGAGTTGGTGTCAGG + Intergenic
1168805531 20:670310-670332 CAGAGCAGAAAGTAGGAGGCCGG - Intronic
1168998651 20:2150828-2150850 CAGAGCACTGAGTAGGTGGCTGG - Intronic
1169043739 20:2518952-2518974 CAGGAAAGAGAGAGGGGGGCAGG - Intronic
1169217807 20:3803555-3803577 CAGGGCAGACACTAGCTGGCTGG - Intronic
1169939854 20:10925340-10925362 CAGGAGAGAGAGCAGATGGCTGG + Intergenic
1170047839 20:12105492-12105514 CAGGGGAGAGAGATGTAGGCTGG - Intergenic
1170448439 20:16455823-16455845 CAATGCAGAGAGAATGTGCCTGG + Intronic
1170525058 20:17228365-17228387 GAGGACAGAGAGAAGGGCGCTGG + Intronic
1171460839 20:25297067-25297089 CAGGACAGAGGGCAGGGGGCAGG - Exonic
1171486472 20:25489808-25489830 CTGGGCAGAGTGGGGGTGGCGGG - Intronic
1172053416 20:32137251-32137273 CCGGGGAGAGGCAAGGTGGCTGG - Intronic
1172117432 20:32581319-32581341 CAGGGCAGAGAGAGGGCGAGGGG - Intronic
1172183400 20:33017013-33017035 TAAGACAGAGAGAAGGAGGCTGG - Intronic
1172282286 20:33716422-33716444 GAAGGCTGAGGGAAGGTGGCTGG - Intronic
1172293434 20:33791747-33791769 CTGGGCAGAGCCATGGTGGCAGG + Exonic
1172306219 20:33882583-33882605 TAGGGCAGAGACAAGGAGGTGGG - Intergenic
1172645548 20:36467064-36467086 CAGGGCCGAGAGAAGGGGGGGGG - Intronic
1172814912 20:37678673-37678695 CAGGGGAGAGAGGCAGTGGCAGG - Intergenic
1172851800 20:37971747-37971769 CAGGGCAGCTGGAAGTTGGCTGG + Intergenic
1173225530 20:41160355-41160377 CAGGGCACACAGCATGTGGCTGG - Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173908881 20:46649461-46649483 CAGAGCAGAGAGAAGCTGTCGGG + Intronic
1174095690 20:48087940-48087962 CAGGGCTGAGAGATGGAGGAGGG - Intergenic
1174197932 20:48786407-48786429 CAGGAGAGAAAGAAAGTGGCGGG + Intronic
1174361164 20:50029736-50029758 CAGGGCAGGGGCAAGGTGGGGGG - Intergenic
1174366804 20:50061446-50061468 CAGGCCACAGGGAAGGTGTCAGG - Intergenic
1174449167 20:50609266-50609288 CAGGGCTGAGAGGGGGTGGGCGG - Intronic
1174567849 20:51479871-51479893 GAGGACAGAGAGAGGGTGGCAGG - Intronic
1174591441 20:51648393-51648415 ATGTGCAGAGAGAAGGTGGAAGG + Intronic
1174750914 20:53110701-53110723 CATGGCAGAGAAAAGTTGGGAGG + Intronic
1174889903 20:54380455-54380477 CTCGGGAGAGAGGAGGTGGCTGG + Intergenic
1175178443 20:57128014-57128036 CTGGGCAGACAGAAGGGAGCAGG - Intergenic
1175192485 20:57220892-57220914 CAGGGCAAAGATACTGTGGCCGG + Intronic
1175307863 20:57989869-57989891 GAGGAGAGAAAGAAGGTGGCTGG + Intergenic
1175466010 20:59191703-59191725 CAGGGGCGAGAGCAGGTGCCAGG + Exonic
1175550391 20:59813725-59813747 CAGGGCTGGGTGAGGGTGGCAGG + Intronic
1175612804 20:60365435-60365457 CAGGGCAGGGAGGGGCTGGCCGG - Intergenic
1175904749 20:62374238-62374260 CGGGGCAGTGGGAAGGTGACGGG - Intergenic
1175931360 20:62495382-62495404 CAGGGCAGACAGATGGATGCGGG + Intergenic
1175998074 20:62820211-62820233 CATGGCAGGGAGAAGGGGGATGG + Intronic
1176022338 20:62968167-62968189 CAGGGCAGTGGGTGGGTGGCGGG + Exonic
1176121039 20:63454724-63454746 CAGGGGAGGGAGAGGGCGGCAGG + Intronic
1176869962 21:14076303-14076325 CAGGGCAGAGGGACTGGGGCCGG + Intergenic
1176922808 21:14708772-14708794 CAAGGCAAGGAGAAGGTGACTGG - Intergenic
1177833473 21:26166292-26166314 CACAGAAGACAGAAGGTGGCAGG - Intronic
1178258856 21:31080174-31080196 CAGGGTAGAGAGAGGTGGGCTGG + Intergenic
1178265752 21:31141609-31141631 CTGAGCAGAGAGTGGGTGGCAGG + Intronic
1179275212 21:39885692-39885714 CAGGGGAGGGAGAGGGTGCCTGG - Intronic
1179396307 21:41043489-41043511 CAGAGCAGAAGGAAGGTGGTGGG + Intergenic
1179474978 21:41637280-41637302 GAGGGCACAGAGCAGGGGGCTGG - Intergenic
1179884820 21:44309372-44309394 CAGGGGTGAGAGGAGGGGGCGGG + Intronic
1179967264 21:44814717-44814739 CAGGGCAGCGAGAAGGAGCCTGG - Intronic
1180009489 21:45040261-45040283 CAGGCAGGAGAGAGGGTGGCGGG + Intergenic
1180618027 22:17141265-17141287 CAGGGCAGATGGCAGGCGGCAGG + Intronic
1180695923 22:17751613-17751635 CCAGGCAGAGAGGAGGTGGCAGG + Intronic
1181110372 22:20599203-20599225 CAGTGGAGAGAGAAGTTGCCTGG + Intergenic
1181760071 22:25052128-25052150 CAGGAGAGAGAGGAGCTGGCAGG - Intronic
1182020356 22:27076379-27076401 CAGGGCAGAATGAAGGGTGCCGG + Intergenic
1182058817 22:27382186-27382208 GAGGGCAGAGTGAAGGAGGCTGG + Intergenic
1182086309 22:27563547-27563569 CAGGGCAGAGGGATGGAGGCAGG - Intergenic
1182151108 22:28027800-28027822 CAGGGCAGGGACAGGCTGGCAGG + Intronic
1182662257 22:31933389-31933411 CTGGGCAGAGTGATGGTGGGAGG - Intergenic
1182960202 22:34465021-34465043 CAGGCCAGGCTGAAGGTGGCAGG + Intergenic
1183361990 22:37387633-37387655 CAGCCCAGGAAGAAGGTGGCAGG - Intronic
1183432507 22:37774296-37774318 TAGGGCAGGAAGAGGGTGGCAGG - Exonic
1183473038 22:38019587-38019609 CAAGGCAGAGAGAGGGAGGGCGG + Intronic
1183485702 22:38086634-38086656 CAGGGCAGAGAGAGGGGCTCAGG + Intronic
1184240676 22:43209928-43209950 CAGGGCAGAGAGGAGGGCCCTGG - Intronic
1184406586 22:44304080-44304102 CAGGGCCCAGAGCAGGTGCCAGG - Intronic
1184468933 22:44684668-44684690 CTGGGCAGAGAGCTGGGGGCGGG - Intronic
1184686214 22:46097536-46097558 CAGGGCTGAGCGAGGGTGGCAGG + Intronic
1184729379 22:46364504-46364526 CAGAGCAGAGGAAAGGTGCCTGG - Exonic
1184742677 22:46438180-46438202 CAAGGCCCAGAGAAGGGGGCCGG + Intronic
1184746348 22:46458384-46458406 CAGGGCAGGACGAGGGTGGCAGG + Intronic
1184806647 22:46798879-46798901 CAGGGCAGGGAGAGGGTTTCCGG + Intronic
1184945661 22:47802069-47802091 CAGGCCAGAGGGAGGGTGCCTGG - Intergenic
1184975508 22:48058728-48058750 CAGGGTAAAGATAAGGTTGCGGG + Intergenic
1185105968 22:48870055-48870077 CAGGGCAGAGAGAAGGGGAATGG - Intergenic
1185160704 22:49227914-49227936 CCAGGAAGAGAGAAGCTGGCAGG + Intergenic
1185392096 22:50567886-50567908 CAGGGGACAGAGCAGCTGGCAGG - Intergenic
950105962 3:10388646-10388668 CAGGGCAGGTAGTAGGTGGTGGG - Intronic
950460888 3:13121708-13121730 GAGAGCAGAGAGAATGGGGCAGG + Intergenic
951752968 3:26057518-26057540 CAGGGCAGAGATACAGAGGCAGG - Intergenic
952597008 3:35029686-35029708 CAGGCCAGAGAGAAGGAGATGGG - Intergenic
953860555 3:46540768-46540790 CAGGGCCACGAGAAGGGGGCAGG - Intronic
953890512 3:46748891-46748913 CAGTGCAGGGACAGGGTGGCAGG + Intronic
954039575 3:47874645-47874667 GAGGGCAGAGGGGAGGTGCCTGG - Intronic
954537510 3:51372343-51372365 CAGGGCAGAGGGCAGGGGGAGGG + Intronic
954691484 3:52397863-52397885 CAGGGCCGGGAGGAGGTGGGTGG + Exonic
955221078 3:57023833-57023855 CAGGGCAGTGAGCATGTGACAGG - Intronic
955424108 3:58769332-58769354 CAGGGCTGAGAGAAGATGTCCGG + Intronic
955943353 3:64167650-64167672 CTGGGCAGAAAGATGGAGGCTGG + Intronic
957610016 3:82453833-82453855 TAGAGCAGGGAGAAGGGGGCAGG - Intergenic
957733602 3:84177521-84177543 GAGGGCAGAGAGTAGGAGGAAGG + Intergenic
959254927 3:103997296-103997318 CAGTGCAGAGAGAAGGCAGAAGG + Intergenic
959620853 3:108397329-108397351 AAGGGCAGAGACATGGGGGCAGG - Intronic
959974435 3:112442532-112442554 GAGGGCAGAGAGAGGGAGGGGGG + Intergenic
960445256 3:117740502-117740524 AAGGGCAGAGTGAAGGTGCTTGG - Intergenic
960554267 3:119010273-119010295 CAGTGGAGTGAGAAGGTTGCTGG - Intronic
960753565 3:120983133-120983155 CAGGCCAGAAAGAAGCAGGCAGG - Intronic
960965862 3:123104307-123104329 CAGGGCAGAGGGAAGGGGACAGG + Intronic
961595315 3:128011354-128011376 CAAGGCGGAGAGAAGGAGCCCGG - Intergenic
961657580 3:128451933-128451955 CAGTGCAGGGAGCAGGTGTCTGG - Intergenic
961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG + Intronic
963057710 3:141200967-141200989 CAAGCCAGAGAGAAGAAGGCAGG + Intergenic
963207624 3:142652566-142652588 GAGGGCACAGAGTAGGAGGCGGG + Intronic
963654369 3:148026123-148026145 CAGGGCAGAGATGAGATAGCAGG + Intergenic
965207912 3:165745291-165745313 CAGCGGAGAGAGCAGGTGACAGG - Intergenic
965802859 3:172512418-172512440 CAGTGATGGGAGAAGGTGGCAGG - Intronic
967055978 3:185828597-185828619 CAAGACAGTGATAAGGTGGCTGG + Intergenic
967278075 3:187795882-187795904 CCTGGCAGAGAGGTGGTGGCCGG - Intergenic
967972838 3:195012071-195012093 GAGGGGAGAGAGAAGGTGTGGGG + Intergenic
968651658 4:1762547-1762569 CAGGGCAGAGGGCAGAAGGCAGG + Intergenic
968653674 4:1769767-1769789 CAGGGATGAGACAAGGAGGCAGG - Intergenic
968808600 4:2790160-2790182 AAGGCCAAAGAGAAGGGGGCCGG - Intergenic
969537410 4:7765204-7765226 CAGGGCAGAGTGGAGATGGGAGG - Intronic
969570052 4:8002882-8002904 CAGTGCAGAGAGACGGTACCTGG - Intronic
970429376 4:15974789-15974811 CAGTGCAAAGAGAAGGTGCTAGG - Intronic
970991384 4:22217426-22217448 TAGTGCAGAGAGCAGGTGTCTGG - Intergenic
971119859 4:23691134-23691156 GAGGGCAGAGTAAAGGTGGGAGG + Intergenic
971328871 4:25665886-25665908 CAGGGCAGAGAGACAGAGACAGG + Intronic
972205594 4:36768425-36768447 CAGGCCAGAGTAAAGGTGGGTGG - Intergenic
972570122 4:40303100-40303122 CAGGAAGGAGAGAAGGAGGCCGG + Intergenic
973607867 4:52605796-52605818 TGGAGCAGAGAGAAGGAGGCAGG - Intronic
973669365 4:53199908-53199930 CATGGCAGAGAGAAGGAGGGAGG + Intronic
973731003 4:53822238-53822260 CCAGGCAGGGAGAAGGTTGCAGG + Intronic
975836048 4:78423032-78423054 AAGGGAAGAGATAAGGTGGCAGG - Intronic
976141592 4:81999051-81999073 TAAGGAAGAGAGTAGGTGGCTGG - Intronic
976151689 4:82099014-82099036 CAGGGAAGGGTGAAGGTGGTAGG - Intergenic
977459610 4:97308951-97308973 CAGGGGAGAGAGAAGGGGAAGGG - Intronic
977786599 4:101042338-101042360 CAGGGCAGAGGGAAGGTGGGAGG - Intronic
981288525 4:143047161-143047183 CAGGGAAGGGTGGAGGTGGCTGG + Intergenic
981552145 4:145952870-145952892 CAGGGTGGAGGGATGGTGGCAGG - Intergenic
981766640 4:148258337-148258359 AAGGAAAGAGAGAAGGAGGCAGG + Intronic
982710691 4:158755956-158755978 CAGGCCAGAGAGGAGGGGGAGGG - Intergenic
983549519 4:169001664-169001686 CAAGAGAGAGAGGAGGTGGCAGG - Intronic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984884312 4:184436652-184436674 CTAGGCAGGGAGAAGGTGGCAGG + Intronic
985716901 5:1467867-1467889 CCAGGCAGAGAGAGGGCGGCGGG - Intronic
985748089 5:1658991-1659013 CAGGCAAGAGAGCAGGTGGCTGG - Intergenic
985825995 5:2192055-2192077 CAGGGCAGAGGCCAGGTGGAAGG - Intergenic
985913855 5:2903131-2903153 CAGGGCAGAAAGCAGATGGCAGG - Intergenic
986014812 5:3748564-3748586 CAGGGGAGAGAGAGGGAGGGCGG - Intergenic
986039085 5:3969476-3969498 CAGGGGAGACAGTAGGAGGCAGG + Intergenic
986149187 5:5111400-5111422 CAGGACAGAGAAGAGGTGCCTGG + Intergenic
986151336 5:5133040-5133062 CGGGCCAGAGGGGAGGTGGCAGG - Intergenic
986365249 5:7022563-7022585 CAGGAAAGAGAGAAGGTGGCAGG + Intergenic
987252922 5:16118854-16118876 CAGGGCAGTGAAGAGGTGGAAGG + Intronic
987550583 5:19375159-19375181 CAGGGCGGAGGGAAGGGAGCAGG + Intergenic
987576030 5:19730019-19730041 CAAAGCAGAAAGAAGGTGGGAGG - Intronic
987747965 5:22001631-22001653 GAGGGCAGAGGGAAGGAGGAGGG - Intronic
987872680 5:23641059-23641081 AAGTGCAGAGTGAAGGTGGCCGG - Intergenic
988187952 5:27890810-27890832 CAGGAGAGAGAGAAGGAGGGGGG - Intergenic
988255178 5:28810225-28810247 CAGGACAAAGAGAAGGCGTCGGG + Intergenic
988450125 5:31333769-31333791 AAGTGCAGAGTGAAGGTGGGGGG - Intergenic
988731574 5:33977762-33977784 CAGAGCACAGAGAATGTGGAAGG + Intronic
989363316 5:40627828-40627850 TAAGGGAGAGAGAAGGTGGTGGG - Intergenic
990012833 5:51021069-51021091 CCTGGCTGAGGGAAGGTGGCAGG + Intergenic
990322334 5:54642144-54642166 AAGGTCTGAGAGAAGGAGGCTGG + Intergenic
990519585 5:56565932-56565954 CAGGGCAGAGTGATCTTGGCAGG - Intronic
991259075 5:64647522-64647544 CAGAGCAGACAGCAGGTGACAGG - Intergenic
991768143 5:70011435-70011457 GAGGGCAGAGGGAAGGAGGAGGG - Intergenic
991847381 5:70886517-70886539 GAGGGCAGAGGGAAGGAGGAGGG - Intergenic
992056738 5:72997754-72997776 CAGGGCAGAGAGGGGTTGGAGGG - Intronic
992109786 5:73482080-73482102 CTGGGCAATGACAAGGTGGCTGG + Intergenic
992457502 5:76929233-76929255 CATGGCAGAGAGAAGGGTGAAGG + Intergenic
992659604 5:78945459-78945481 AAAGGCAGAGGGAAGGTGGATGG - Intronic
993905004 5:93612618-93612640 AAGGGGAGAGGGAAGGGGGCGGG + Intergenic
994731066 5:103490740-103490762 AAAGGGAGAGAGAAGGTGGGTGG - Intergenic
995379158 5:111512618-111512640 GGGGGCTGAGAGGAGGTGGCCGG + Intergenic
996363273 5:122673993-122674015 GAGGGAGGAGAGAAGGTGTCAGG + Intergenic
996583293 5:125055784-125055806 CAGGGCAGAGACTAGGTTGAAGG + Intergenic
997207211 5:132056950-132056972 CTGGGCAGAGCAAAGGAGGCAGG - Intergenic
997284302 5:132667527-132667549 CAGGGGAGAGGGCAGGCGGCGGG - Intergenic
997597067 5:135114133-135114155 CAGGGCAGAGAGAAGCCGCCAGG + Intronic
997608360 5:135192598-135192620 TAGGGGAGAGAGAAGGTGTCTGG - Intronic
997702994 5:135917897-135917919 TAGGGCAGAGGGAAGGAGGGAGG + Intergenic
998059088 5:139105029-139105051 CAGGGCAGGGATAGGGCGGCAGG + Intronic
998161724 5:139816773-139816795 GAGGGCACAGACAAGCTGGCCGG - Intronic
998340192 5:141410344-141410366 CAGGGCTGAGAGAGCGTCGCAGG - Exonic
999258185 5:150221559-150221581 CAGGGCAGAGAGGAGGAGGGAGG - Intronic
999316699 5:150588671-150588693 CAGGGGAGAGAAGAGGAGGCTGG + Intergenic
1000030184 5:157394742-157394764 CAGGGAAGAGAGAAGGGAGGAGG + Intronic
1000171579 5:158707851-158707873 GAGGGCAGAGAGAATCAGGCAGG + Intronic
1000752184 5:165110774-165110796 TAAGGCACAGAGAAGCTGGCTGG - Intergenic
1000895241 5:166847357-166847379 GAGTTCAGAGAGAAAGTGGCTGG + Intergenic
1002102959 5:176866392-176866414 GAGGGAGGAGAGGAGGTGGCAGG + Intronic
1002521095 5:179793636-179793658 CAGGGAACAGATAAGGTGGGTGG + Intronic
1002661030 5:180791271-180791293 CAGGTCAGGGAGAAGGGGTCTGG + Exonic
1002803614 6:550895-550917 CAGGGCAGAGAAGATGTGGCAGG - Intronic
1003550956 6:7101580-7101602 CCAGGCAGAGAGGAGGGGGCAGG - Intergenic
1003872334 6:10412878-10412900 GAGGGCAGAGCGACGGTGGCCGG - Intronic
1004291548 6:14372144-14372166 GAGGGCAGAGGCAAGGAGGCTGG + Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006297443 6:33176200-33176222 CAGTGAAGAGAGGAGATGGCAGG + Intronic
1006371924 6:33650146-33650168 AAGGGCAGAGAGAAGGAGGGTGG - Intronic
1006470075 6:34223789-34223811 TAAGGCAGACAGAAGGTGGGAGG - Intergenic
1006598212 6:35208951-35208973 CAGTGGAGAGAGAAGGGAGCAGG + Intergenic
1006640372 6:35486405-35486427 GAGGGCAGAGAGCAGGGGGAAGG + Intronic
1006793482 6:36718137-36718159 CCGGGCAGTGGGAAGGAGGCAGG - Intronic
1006815663 6:36848247-36848269 CCGGGCAGAGAGGAAATGGCAGG - Intergenic
1007419534 6:41711497-41711519 CAGGGAAGAGAGATGCTGGAAGG - Intronic
1007515263 6:42405857-42405879 CAAGACAGAGAGAAGCAGGCAGG + Intronic
1007756111 6:44100881-44100903 GAGGGAGGAGAGAAGGTGGCTGG - Intergenic
1007924920 6:45643025-45643047 GAGGGCAGAGAGAAGGGGAAAGG - Intronic
1008360604 6:50613251-50613273 CAGTGGGGAGAGGAGGTGGCAGG - Intergenic
1008415699 6:51237453-51237475 CAGGGAAGGGAGAAGGTGGGAGG + Intergenic
1008603643 6:53119577-53119599 CTGGGAAGACAGAATGTGGCAGG - Intergenic
1011735010 6:90301887-90301909 CAGAGAGGAGGGAAGGTGGCTGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012294387 6:97502605-97502627 GAGGGTAGTGAGAATGTGGCTGG + Intergenic
1013423290 6:109986369-109986391 GAGACCAGAGAGGAGGTGGCAGG + Intergenic
1013551679 6:111213794-111213816 CAGGCCACACAGCAGGTGGCTGG - Intronic
1013720505 6:113020955-113020977 AAGGGCAGAAAAAAGGTGGAAGG + Intergenic
1014214504 6:118739309-118739331 CAGGGCAGAGAGACAGTGGAGGG + Intergenic
1014545698 6:122733045-122733067 CAGGGAAAAAAGAAGGTGGTGGG - Intergenic
1014957268 6:127636303-127636325 AAGAGCAGAGAGAATGTGCCAGG - Intergenic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015464290 6:133531130-133531152 AAGGGCAAAGAGAAGCCGGCTGG + Exonic
1015882559 6:137883640-137883662 CAGGAAAGAGAGAAGTAGGCAGG + Intergenic
1016896017 6:149053981-149054003 CAGGGGTGACAGATGGTGGCAGG - Intronic
1018205733 6:161435956-161435978 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1018205744 6:161435983-161436005 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1018205755 6:161436010-161436032 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1018205800 6:161436174-161436196 GAGGGCAGAGAGCAGGGGGCAGG + Intronic
1018205841 6:161436311-161436333 GAGGGCAGAGAGGAGGAGGCGGG + Intronic
1018549666 6:164981303-164981325 CAGAGCAGAGAGAAGGGGAAAGG + Intergenic
1018908373 6:168088144-168088166 CGGGGCTGAGAGAAGCTGGTGGG + Intergenic
1019013335 6:168860897-168860919 GGGGGCAGAGAGGAGGAGGCAGG + Intergenic
1019021100 6:168918414-168918436 CATGGCAGAGAGAAGCTGCCAGG - Intergenic
1019192287 6:170259342-170259364 CAGGGCAGGGAGGAGGTGCCAGG - Intergenic
1019557722 7:1641005-1641027 CTGGGAAGAGAGGAGGTGGAGGG - Intergenic
1019579302 7:1752188-1752210 CTTGGCAGAGACAAGGCGGCAGG + Intergenic
1019633612 7:2063852-2063874 GAGGGCAGAGCGAGGGAGGCTGG - Intronic
1019818397 7:3218383-3218405 CAGGGCAAAAGGAAGGTTGCGGG - Intergenic
1019853672 7:3583820-3583842 CACTGGAGAAAGAAGGTGGCAGG + Intronic
1020076797 7:5263665-5263687 CAGGCCAGAGAGAGGTGGGCTGG + Intergenic
1020101309 7:5395561-5395583 CAGGTCAGAGAGAAGCATGCAGG + Intronic
1020129288 7:5550483-5550505 CAGGGCAGAGAGAAAGGGGTAGG - Intronic
1020149863 7:5673541-5673563 CAGGGAAGAGAGCAAGTTGCAGG + Intronic
1021270685 7:18581280-18581302 CAAGACTGAGAGAAAGTGGCAGG - Intronic
1022319980 7:29279027-29279049 CATTGCAGAGAGAAGGAAGCAGG - Intronic
1022381192 7:29861434-29861456 CAGGGCAAAGGGGTGGTGGCAGG + Intronic
1022590360 7:31655416-31655438 CAGTTTGGAGAGAAGGTGGCTGG - Intronic
1022923511 7:35038004-35038026 CGGGGCAGGGAGAAGGCGCCCGG + Exonic
1023031743 7:36095642-36095664 GAGGGAAGAGAGAAGGAAGCGGG + Intergenic
1023276316 7:38522502-38522524 GAGGGCAGAGAGAATGCAGCAGG + Intronic
1023358835 7:39395372-39395394 GAGGGCAGTGAGAAGGTGAGAGG - Intronic
1023369859 7:39502407-39502429 GAGGACAAAGAAAAGGTGGCAGG - Intergenic
1023539935 7:41254185-41254207 CAGGGCAGAGAAAAAGTGTCAGG + Intergenic
1023789158 7:43737915-43737937 GAGGACAGAGAGAGGGTGGGAGG + Intergenic
1023806920 7:43878893-43878915 CAGGGCACAGAGAAGGTCTAAGG + Exonic
1024178472 7:46864085-46864107 CAGGGCACAGTGAAGGTGGAGGG - Intergenic
1024540133 7:50469321-50469343 TAGTGCATAGAGAAGGTGTCTGG + Intronic
1024684795 7:51733711-51733733 CAGGGAAGAGAGCATGTGGAGGG + Intergenic
1025202298 7:56969929-56969951 CAGGCCAGAGAGAGGTGGGCCGG - Intergenic
1025610594 7:63072897-63072919 CAGGGCAGAGTGGAGTTGGTGGG - Intergenic
1025669649 7:63606998-63607020 CAGGCCAGAGAGAGGTGGGCCGG + Intergenic
1025746573 7:64248247-64248269 CCGGGCAGAGACCAGGTGGGAGG - Intronic
1026037497 7:66840158-66840180 CAGGACAGTGAGCAGGTGCCTGG - Intergenic
1026175133 7:67989958-67989980 CAGGTCAGAGAGGAGATGGAGGG - Intergenic
1026185786 7:68081864-68081886 CTGTGAAGAGAGAAGGTGGTGGG + Intergenic
1026643808 7:72150638-72150660 CAGAGCAGAGAGAACGTGAGAGG + Intronic
1026994155 7:74605099-74605121 CAGAGCAGACACAGGGTGGCTGG + Intergenic
1027617030 7:80436093-80436115 CAAGAAAGAGAGAAGGTGGGGGG - Intronic
1028239896 7:88406948-88406970 CAGGGCTGAGAGAGGGAGGGGGG - Intergenic
1028417330 7:90595195-90595217 CAGGGGAGAGAGAAGGAAGGTGG - Intronic
1028994629 7:97086162-97086184 CAGGGCAGGTAGAGGGAGGCAGG + Intergenic
1029530529 7:101122299-101122321 GAGGTCAGAGAGAAGGGAGCAGG + Intergenic
1029599123 7:101553571-101553593 CAAGAGAGTGAGAAGGTGGCTGG + Intronic
1029638667 7:101803981-101804003 TGGGGCAGAGAGAAGGTCACAGG - Intergenic
1030329083 7:108253854-108253876 CAGGGATGACAGAAGGTTGCTGG + Intronic
1030338166 7:108347873-108347895 CAGGGCAGGGCTAAGGTGGAGGG - Intronic
1030380365 7:108803965-108803987 CAGGGAGGAGAGAGGGAGGCAGG - Intergenic
1031483321 7:122303368-122303390 CCGGGCAGAGAGAGGGTAGGAGG + Intronic
1031664944 7:124472413-124472435 CAGGGCAGAGGGTGGGTGGTAGG + Intergenic
1031915243 7:127556806-127556828 CAGGCCAGAGAGCATGTGGAGGG - Intergenic
1031972269 7:128073452-128073474 GTGTGCAGAGAGAAGGTAGCGGG - Intronic
1031978460 7:128108305-128108327 CAGGGCAGAGAGCAGGGTGGAGG + Intergenic
1031989488 7:128188445-128188467 CAGGGGAGAGAGACGGCAGCAGG + Intergenic
1032019640 7:128400216-128400238 CAGGTGAGAGAGAAGGAGCCAGG + Intronic
1032112358 7:129086885-129086907 CAGGTCAGAGTGAGGGTGGCTGG + Intergenic
1032166735 7:129551195-129551217 CAGCGCACAGAGCAGGTTGCTGG + Intergenic
1032496749 7:132368532-132368554 CTGGGCAGACAGAGGGTGACAGG - Intronic
1032708639 7:134443579-134443601 CAGGGCAGGGAGCACATGGCAGG + Intronic
1033035682 7:137873894-137873916 AAGGCCACAGAGGAGGTGGCTGG + Intergenic
1033423352 7:141221747-141221769 GAGGGCAGCAGGAAGGTGGCTGG + Intronic
1033454645 7:141491862-141491884 CAGGGGAGAGATGAGGAGGCAGG - Intergenic
1033568626 7:142604928-142604950 AAGGGGAGAGAGAAAGGGGCTGG - Intergenic
1033583329 7:142755819-142755841 GAGGGAAGAGAGAAGGAGGGTGG - Intronic
1033586340 7:142777327-142777349 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1033656845 7:143380882-143380904 CAGGCCCGAGAGGAGGTCGCTGG + Intergenic
1034226754 7:149490536-149490558 CAGGGCAGTGAAAAGGCAGCAGG + Intronic
1034263623 7:149771745-149771767 CGGGGCAGAGGGAAGGCTGCCGG - Intronic
1034409396 7:150931839-150931861 CAGGGGAGAGAAAAGGATGCTGG + Intergenic
1034471806 7:151258744-151258766 CAGGGCAGAGAGAAGGTGGCGGG - Intronic
1034585431 7:152087456-152087478 GAATGCAGAGAGAAGGTGGTGGG + Intronic
1035118000 7:156540921-156540943 CAGGCCAGGAAGCAGGTGGCAGG + Intergenic
1035222634 7:157415138-157415160 CTGGGCAGAGGGAACATGGCCGG - Intronic
1035669826 8:1408853-1408875 CAGGGCACAGAGAAGAAAGCTGG + Intergenic
1035741359 8:1930598-1930620 CAGAGCAGAGAGAACGGGGGTGG - Intronic
1035754753 8:2022912-2022934 CGGGGCAGACAGAGGGAGGCAGG - Intergenic
1035764050 8:2091556-2091578 CACGACAGAGAGAGGGTGGAGGG - Intronic
1036460480 8:8948243-8948265 CTGGAAAGAGAGAAGTTGGCAGG - Intergenic
1036931984 8:12965351-12965373 CAGAGCATAGAGATGGTGGCAGG + Intronic
1037596551 8:20359061-20359083 CAGGGAAGAGTTAAGGTTGCAGG - Intergenic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037819778 8:22130053-22130075 GAGGGGAGAGGGAAGGAGGCGGG + Intronic
1038024765 8:23578529-23578551 ATGAGCAGAGAGGAGGTGGCAGG - Intergenic
1038391579 8:27206977-27206999 CAGGGGAGAAAGGTGGTGGCAGG - Intergenic
1038541183 8:28391448-28391470 CAGGCTAGAGAGATGGTGGCTGG - Intronic
1039797034 8:40924521-40924543 CAGAACAGAGGGCAGGTGGCTGG + Intergenic
1041022075 8:53648209-53648231 CAGGGCAGTTAGGGGGTGGCAGG - Intergenic
1041060912 8:54033518-54033540 CAGGGCAGGGAGGAAGTGCCAGG + Intergenic
1041124538 8:54621779-54621801 CAGGGAAGAGAGAAAGGGGTAGG - Intronic
1041215529 8:55596382-55596404 CAGGGCAGGAGGAAGGAGGCAGG - Intergenic
1041289421 8:56294625-56294647 CAGGGCAGTGAGAAGGGAGCAGG + Intergenic
1041688343 8:60665071-60665093 GAGGGCAGAGCCTAGGTGGCTGG - Intergenic
1042574061 8:70198707-70198729 GAGGTAAAAGAGAAGGTGGCTGG + Intronic
1042816904 8:72887826-72887848 CTGGGCAGAGAGAAAGTGTAGGG - Intronic
1044130098 8:88511712-88511734 CAGGACAGAGAGAAAATGGGGGG - Intergenic
1045718270 8:105074454-105074476 CAGGCCAGAGTGAAGGGGTCAGG + Intronic
1047360788 8:124167041-124167063 GAAGGTAGAGAGAAGATGGCAGG - Intergenic
1048211698 8:132459461-132459483 CAAGGCAGAGGAAAGGTGTCAGG + Intronic
1048496511 8:134940277-134940299 CAGGGCAGGGGGCAGGTGGGGGG + Intergenic
1048512826 8:135078079-135078101 GAGGGCAGAGAGAAGGAAGAGGG - Intergenic
1048886924 8:138916212-138916234 CAGGGCACAGATGAGGGGGCTGG + Intergenic
1049154230 8:141057092-141057114 TGGGGCAGAGAGAAGGGGGTGGG - Intergenic
1049194945 8:141309872-141309894 CAGGGCACAGAGGACGTGTCTGG + Intergenic
1049270479 8:141693077-141693099 CAGGCCAGAGAGGAGGAGACAGG + Intergenic
1049298994 8:141859815-141859837 CAGGGGAGAGGAAAGGTGGCTGG - Intergenic
1049383459 8:142329276-142329298 CAGGGGAGAGCCAAGGTGCCGGG + Intronic
1049519649 8:143081339-143081361 CCGGGCAGAGGGCAGGTGCCAGG + Intronic
1049530450 8:143151920-143151942 CAGGGTGGACGGAAGGTGGCGGG - Intergenic
1049591744 8:143465893-143465915 CAGGGCCCAGAGACGGTGGCTGG + Intronic
1049792105 8:144476857-144476879 CACAGCAGAGAGGTGGTGGCAGG - Intergenic
1049804110 8:144531183-144531205 CAGGGCAGAGAGCAGCAGGTGGG + Intronic
1050301597 9:4264327-4264349 CTGGGGAGAGAGATGGTCGCTGG - Intronic
1050367051 9:4882274-4882296 CTGGGCAGAAAGAAGCTGCCAGG - Intronic
1051602507 9:18889475-18889497 CAGGGCAGGGAGAAGGTGACAGG - Intronic
1051644987 9:19259238-19259260 AAGGGCAGTGGGGAGGTGGCGGG - Intronic
1052520472 9:29541536-29541558 AAGGACAGAGAGATGGAGGCAGG - Intergenic
1052832385 9:33227101-33227123 GAGGGAAGAGAGAAGTTGGGTGG - Intronic
1052902088 9:33801985-33802007 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1053346034 9:37378824-37378846 CAGGGCAGAGTGAAGGCCTCGGG - Intergenic
1054890619 9:70247010-70247032 CAGGGCATAGAGCAGGTTGAGGG + Intergenic
1054959122 9:70947630-70947652 CAGAGCTCAGAGAAGGTGGGGGG + Intronic
1056559644 9:87718973-87718995 CAGGTCACAGAGCAGGTGGAGGG - Intergenic
1056791910 9:89631457-89631479 CAGGACAGGGAGGAGGTGCCTGG + Intergenic
1058201500 9:102047651-102047673 CAGGGGAGGGACAAGGTGGGAGG + Intergenic
1059341919 9:113602158-113602180 CGGGGCAGAGGGAGGGAGGCTGG + Intergenic
1059420406 9:114187003-114187025 CAGACCAGAGACAAGGTGGCTGG - Intronic
1059667884 9:116466345-116466367 CAGAGATAAGAGAAGGTGGCTGG - Intronic
1059998782 9:119939545-119939567 CAGGGGAGAGAAAAGGTGCTGGG + Intergenic
1060407766 9:123381340-123381362 CTGGGCAGAGAGAGAGTGGCGGG + Exonic
1060706459 9:125806261-125806283 CAGTGAAGAGACTAGGTGGCTGG + Intronic
1060741729 9:126103201-126103223 CAGAGGAGAGAGCAGGTGGAAGG - Intergenic
1060882748 9:127129792-127129814 GAGGGAAGAGAGAAGGCGGTGGG - Intronic
1061013906 9:127971146-127971168 CTGCCCAGAGAGGAGGTGGCCGG - Intronic
1061566167 9:131441906-131441928 CATGGCAGAGAACAGATGGCAGG + Intronic
1061825616 9:133256573-133256595 GAGGGCTGAGGGCAGGTGGCTGG + Intronic
1062073200 9:134570173-134570195 GAGGGCAGAGCTAGGGTGGCAGG + Intergenic
1062140533 9:134955424-134955446 CAGAGCAGAGGGAAGGCAGCTGG + Intergenic
1062191350 9:135249461-135249483 CAGGGCAGAGTGAGGCTGGGTGG - Intergenic
1062231961 9:135486835-135486857 CACGGCAGAGAGGATGAGGCAGG + Exonic
1062239128 9:135526470-135526492 CAGGGCAGGGGGAAGGCGGGGGG - Exonic
1062648548 9:137563652-137563674 GAGGGCAGAGAGCATGTGGGTGG + Intronic
1062686613 9:137816967-137816989 CAGGGCTGGGGGAAGGTGGTTGG - Intronic
1062686629 9:137817013-137817035 CAGGGCTGGGGGAGGGTGGCAGG - Intronic
1185747159 X:2583011-2583033 CAGGGCAGACAGAAGCTGTTTGG - Intergenic
1185877195 X:3711474-3711496 CGGGGCAGAGAGCAGGATGCGGG - Intronic
1186289354 X:8079900-8079922 CAGGGGAGAGAGCAGGTAGGAGG + Intergenic
1187271060 X:17780085-17780107 AAGGGAAGAGAAAAGGTGGAAGG + Intergenic
1187319296 X:18226086-18226108 CTGGGAAGAGAGAAGCTCGCTGG + Intergenic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1189185056 X:39047635-39047657 CAGGGAGGAGAGAAGGTGGTGGG - Intergenic
1189480620 X:41389702-41389724 CAGGACAGAGAGAGGAGGGCGGG + Intergenic
1189760322 X:44315523-44315545 CAAGGCAGAGAGAGGGAGACTGG + Intronic
1190123188 X:47680426-47680448 TGGGGCAGAGAGAAAGTGGAAGG + Intergenic
1190817457 X:53940614-53940636 CAGGTAAGGGAGAGGGTGGCAGG - Intronic
1193329768 X:80223114-80223136 CAGGGCAGGGATATAGTGGCAGG + Intergenic
1194322063 X:92460714-92460736 CCGGGCAGAGAGACAGTGCCAGG + Intronic
1195237649 X:102917561-102917583 AATGACAGAGAGAAGGTGGGAGG + Intergenic
1198428407 X:136542142-136542164 GAGGGGAGAGAGAAGGAGGCTGG - Intronic
1198875153 X:141216742-141216764 CAGGACAAAGGGAAGGTGGTTGG + Intergenic
1199417243 X:147599502-147599524 CAGGGCAGAGAGAGGGAGGGAGG - Intergenic
1199482087 X:148308937-148308959 CCGGGCAGGGAGAAGGTTGTGGG + Intergenic
1199677461 X:150200197-150200219 CACGCCTGAGAGAGGGTGGCTGG + Intergenic
1200100584 X:153687772-153687794 GAGGGCAGGGAGGAGGTGGGCGG + Intronic
1200182596 X:154159845-154159867 CAGGGCAGAGGGGAGGGCGCAGG + Intergenic
1200188250 X:154196959-154196981 CAGGGCAGAGGGGAGGGCGCAGG + Intergenic
1200193900 X:154234099-154234121 CAGGGCAGAGGGGAGGGCGCAGG + Intergenic
1200199655 X:154271903-154271925 CAGGGCAGAGGGGAGGGCGCAGG + Intronic
1200788090 Y:7276032-7276054 CGGGGCAGAGAGCAGGATGCGGG + Intergenic
1201321110 Y:12699449-12699471 AAGTGCAGACTGAAGGTGGCTGG + Intergenic
1201687460 Y:16722709-16722731 AAGGACAGAGAGAAAGTGGTGGG + Intergenic
1201788919 Y:17816457-17816479 CAGAGGAGAGGGCAGGTGGCTGG + Intergenic
1201812634 Y:18089530-18089552 CAGAGGAGAGGGCAGGTGGCTGG - Intergenic
1202350525 Y:23985532-23985554 CAGAGGAGAGGGCAGGTGGCTGG + Intergenic
1202520254 Y:25684589-25684611 CAGAGGAGAGGGCAGGTGGCTGG - Intergenic