ID: 1034472251

View in Genome Browser
Species Human (GRCh38)
Location 7:151261498-151261520
Sequence GGGGTCCCTCACGTGATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034472250_1034472251 -8 Left 1034472250 7:151261483-151261505 CCATCTGCAAAACTGGGGGTCCC 0: 1
1: 0
2: 0
3: 29
4: 232
Right 1034472251 7:151261498-151261520 GGGGTCCCTCACGTGATGCATGG No data
1034472243_1034472251 3 Left 1034472243 7:151261472-151261494 CCTCAATTTCCCCATCTGCAAAA 0: 4
1: 87
2: 987
3: 4795
4: 12427
Right 1034472251 7:151261498-151261520 GGGGTCCCTCACGTGATGCATGG No data
1034472248_1034472251 -6 Left 1034472248 7:151261481-151261503 CCCCATCTGCAAAACTGGGGGTC 0: 1
1: 0
2: 15
3: 136
4: 1096
Right 1034472251 7:151261498-151261520 GGGGTCCCTCACGTGATGCATGG No data
1034472242_1034472251 13 Left 1034472242 7:151261462-151261484 CCTGTCTGAGCCTCAATTTCCCC 0: 1
1: 14
2: 294
3: 1688
4: 5209
Right 1034472251 7:151261498-151261520 GGGGTCCCTCACGTGATGCATGG No data
1034472249_1034472251 -7 Left 1034472249 7:151261482-151261504 CCCATCTGCAAAACTGGGGGTCC 0: 1
1: 0
2: 1
3: 27
4: 263
Right 1034472251 7:151261498-151261520 GGGGTCCCTCACGTGATGCATGG No data
1034472241_1034472251 18 Left 1034472241 7:151261457-151261479 CCTGACCTGTCTGAGCCTCAATT 0: 1
1: 1
2: 29
3: 228
4: 936
Right 1034472251 7:151261498-151261520 GGGGTCCCTCACGTGATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034472251 Original CRISPR GGGGTCCCTCACGTGATGCA TGG Intronic
No off target data available for this crispr