ID: 1034473209

View in Genome Browser
Species Human (GRCh38)
Location 7:151267410-151267432
Sequence ATAGTGACTCAGAAAGAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 311}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034473209_1034473214 24 Left 1034473209 7:151267410-151267432 CCGTGTTCTTTCTGAGTCACTAT 0: 1
1: 0
2: 1
3: 22
4: 311
Right 1034473214 7:151267457-151267479 GAATGTACTGCGAAGTCCTCAGG No data
1034473209_1034473216 26 Left 1034473209 7:151267410-151267432 CCGTGTTCTTTCTGAGTCACTAT 0: 1
1: 0
2: 1
3: 22
4: 311
Right 1034473216 7:151267459-151267481 ATGTACTGCGAAGTCCTCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 77
1034473209_1034473217 30 Left 1034473209 7:151267410-151267432 CCGTGTTCTTTCTGAGTCACTAT 0: 1
1: 0
2: 1
3: 22
4: 311
Right 1034473217 7:151267463-151267485 ACTGCGAAGTCCTCAGGGGTTGG No data
1034473209_1034473215 25 Left 1034473209 7:151267410-151267432 CCGTGTTCTTTCTGAGTCACTAT 0: 1
1: 0
2: 1
3: 22
4: 311
Right 1034473215 7:151267458-151267480 AATGTACTGCGAAGTCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034473209 Original CRISPR ATAGTGACTCAGAAAGAACA CGG (reversed) Intronic
900952555 1:5866048-5866070 CTAGGGACTCAGCAAGAAAAAGG + Intronic
903094288 1:20955062-20955084 AGAGGGATGCAGAAAGAACAGGG + Intronic
903411898 1:23151509-23151531 ATAGAGGAGCAGAAAGAACATGG + Intronic
903533009 1:24046490-24046512 TTTCTGACTCAGAATGAACAGGG + Intergenic
903725806 1:25443484-25443506 ACTGTGACTCAGTAAGAACTGGG + Intronic
904165142 1:28549581-28549603 ACAGTGAGACAGTAAGAACAGGG + Intergenic
904483643 1:30809696-30809718 ATAATGACTCAGAGAGAGCCTGG - Intergenic
905603059 1:39270546-39270568 ATAAGGACTCAGCAAGACCATGG + Intronic
906055613 1:42914410-42914432 AAAGTGACTCATCAAGCACAAGG + Intergenic
906152583 1:43596213-43596235 GGAGTGACTGAGCAAGAACAAGG + Intronic
906864610 1:49403937-49403959 AGAGTGACTCAGATAGAAGAGGG - Intronic
907774784 1:57503320-57503342 CTAGAGACTGAGAAACAACAAGG - Intronic
908365230 1:63415395-63415417 ATGGTAAATCATAAAGAACAAGG - Intronic
908425511 1:64003418-64003440 ATAGTCACAAAGAAAGAAGATGG - Intronic
908652301 1:66348300-66348322 ATAGTAACTGAGAAAAATCAAGG - Intronic
909719378 1:78749979-78750001 AAAATGGCTCAGAAAGAAAAGGG + Intergenic
909769654 1:79404823-79404845 AAAGTGACTCAGTAGGAAAATGG - Intergenic
910022706 1:82611618-82611640 ATACCTACTCAGAAAGAAGATGG + Intergenic
910677379 1:89828218-89828240 ATAGTGACCCAAACAGCACATGG + Intronic
912228014 1:107758168-107758190 ATAGTGAGGGAGAGAGAACAGGG - Intronic
912775403 1:112503565-112503587 ACAGAGAGTCAGAAACAACATGG + Intronic
913105136 1:115607319-115607341 ATACTGACTCAAAAAGAAATAGG + Intergenic
913129470 1:115826916-115826938 ATAGTGTAACAGAAGGAACAGGG - Intergenic
913189378 1:116400630-116400652 AAAGTGACTCAAAAAGCAGAGGG + Intronic
913480041 1:119279556-119279578 ACAGTGAGTCAGAAAGACAAAGG + Intergenic
915492813 1:156260815-156260837 AGAGGGGCTCAGGAAGAACAAGG + Intronic
915921498 1:159979004-159979026 TTAGTGCCTCATAAAGAATAAGG - Intergenic
915952171 1:160196776-160196798 ATATTGTATTAGAAAGAACATGG - Intronic
916035337 1:160917074-160917096 TTAAGGACTCAGAAAGGACAAGG + Intergenic
916366444 1:164034004-164034026 AAAATGACTCATCAAGAACAAGG - Intergenic
916912044 1:169361378-169361400 AAAGTGAATCAGAAAGCACAGGG - Intronic
917000206 1:170349523-170349545 AGAGTCTCTCAGAAAGAAAATGG + Intergenic
918617879 1:186568434-186568456 ATATTGACTCAGAGAGAGTAAGG + Intergenic
919037930 1:192340395-192340417 AAAGAGACTCAGAAAGGTCAAGG + Intronic
919343133 1:196339227-196339249 AGAGTGTTTCAGGAAGAACATGG + Intronic
919521112 1:198588881-198588903 ATAGTAACCAAGAGAGAACAGGG - Intergenic
921113161 1:212058971-212058993 AGACTGAATCAGAAAGAACTAGG + Intronic
922034449 1:221834854-221834876 ATAGTAACTCAGAAGGTAGAGGG - Intergenic
922088561 1:222373847-222373869 ATAGTGAGCCTGAAAGGACAGGG - Intergenic
922257071 1:223901645-223901667 GTAGAGCCACAGAAAGAACATGG + Intergenic
922486262 1:225975603-225975625 TTAAGGAATCAGAAAGAACAGGG + Intergenic
923168650 1:231392452-231392474 ATAGTGAATCAGACAGACCTGGG - Intronic
923285160 1:232487174-232487196 ATCCTGTCTCAGAAAGAAAATGG - Intronic
923378939 1:233395226-233395248 ATATTTACACAGAAACAACAGGG + Intergenic
924081549 1:240404330-240404352 ATAGTTACTCAGAAAGATTCTGG - Intronic
924180232 1:241433599-241433621 AAAGAAACTCAGAAAGAACATGG - Intergenic
924338264 1:243004456-243004478 GTAGAGCCACAGAAAGAACATGG + Intergenic
1064453135 10:15461653-15461675 TCAGTGACCCAGAAAAAACAAGG + Intergenic
1064497269 10:15925236-15925258 ATAATGACCAAGAGAGAACAGGG - Intergenic
1065432818 10:25676611-25676633 ATAGTGAGGCAGAAATAAAAGGG + Intergenic
1065954569 10:30682545-30682567 ATGGTGACTCAGAAAGATGGTGG - Intergenic
1066555257 10:36605476-36605498 ATGGTGACTCAGGATGAAGATGG + Intergenic
1068990003 10:63140423-63140445 ATACTGTCTCAAAAAGAAAAGGG - Intronic
1069219411 10:65864805-65864827 ATAGGGAATCAGAATGAAGAAGG + Intergenic
1070529205 10:77321770-77321792 TTACTGAAGCAGAAAGAACATGG - Intronic
1071061496 10:81575240-81575262 ATACTTACTCAGAAAGACCAAGG + Intergenic
1072736680 10:97883830-97883852 TCAGAGACTCAGAAAGAACCAGG + Intronic
1073849234 10:107595248-107595270 AGAGTAAATTAGAAAGAACAGGG + Intergenic
1074009461 10:109461915-109461937 ATAGTGGCTGAGGAATAACAAGG - Intergenic
1074329432 10:112490012-112490034 ATAGAGAGTTAAAAAGAACAAGG - Intronic
1075467740 10:122664213-122664235 ATAGTGACTCAGAAGGTAGGTGG + Intergenic
1076552848 10:131295163-131295185 ACTGTGACACAGAAATAACAAGG - Intronic
1080047543 11:27825149-27825171 TTAGAGACTCAGAAAGGGCAGGG - Intergenic
1081290773 11:41322768-41322790 ATAGTTACTCAGAAGGGAAAAGG + Intronic
1081418987 11:42849816-42849838 AGAGTGACTTAGAGAGAAAAAGG + Intergenic
1082689234 11:56279534-56279556 TTAGGGACTCAGGAAGGACAAGG - Intergenic
1086131321 11:83405401-83405423 GTAGTGACTCAGACAGACCTGGG - Intergenic
1087750211 11:101998919-101998941 ATGGTGTGGCAGAAAGAACATGG - Exonic
1089118899 11:116118135-116118157 ACAGTGAGTCGGAAAGAAAAGGG - Intergenic
1089866329 11:121635411-121635433 ATAGTTACTACCAAAGAACAGGG - Intergenic
1090067187 11:123513153-123513175 ATAGTATCTCAGAAATAAAAAGG - Intergenic
1090535877 11:127641125-127641147 ACAGTGTCTCAGAAAGACTATGG - Intergenic
1090869438 11:130730051-130730073 ATAGAGAATGAGAAAGAAAAAGG - Intergenic
1090993404 11:131841276-131841298 ATAGTGACACAGCAAGATGATGG + Intronic
1091127877 11:133118204-133118226 AGAGAGTCCCAGAAAGAACAGGG - Intronic
1091159071 11:133402992-133403014 ATATAGTCACAGAAAGAACATGG - Intronic
1093304554 12:17497963-17497985 ATAGTGTTGCAGACAGAACAAGG + Intergenic
1095525805 12:43123685-43123707 ATACTGACCCACAAAGCACAGGG + Intergenic
1099067602 12:78003109-78003131 ATAGTGACTCAAAAGAAACATGG - Intronic
1099259069 12:80353728-80353750 ATAGTAACTGAGAAAAAGCATGG + Intronic
1099758368 12:86885711-86885733 ATAGTGTTTCAGAGAGAAGAGGG - Intergenic
1103073890 12:117967186-117967208 AAAGTTACTCAGAAAGAAGATGG - Intronic
1103280202 12:119751482-119751504 CTAGTCTCTCAGAAAGAACAAGG + Intronic
1105348469 13:19595329-19595351 ATAGTTAATAAGAAAGAAGATGG - Intergenic
1106428949 13:29660913-29660935 ATAGTAACACAGCAAGAACAAGG + Intergenic
1106615279 13:31320873-31320895 ATGGTGAGTCCAAAAGAACAAGG - Intronic
1107480785 13:40784494-40784516 ATAGTTAATAAGAAAGAAAATGG - Intergenic
1108016593 13:46083256-46083278 AGGGTAAATCAGAAAGAACATGG - Intronic
1108940373 13:55945903-55945925 ATATTGACTAAAAAAGACCATGG + Intergenic
1109133364 13:58616065-58616087 ATAGTAAATCAGAAAGAAACAGG + Intergenic
1110101588 13:71613062-71613084 AAAGTGCAACAGAAAGAACAGGG + Intronic
1110766833 13:79289756-79289778 CCAGTGACTGAGAAAGGACATGG - Intergenic
1113041080 13:106104435-106104457 AAAGTGAGTCAGAAAGAAAGGGG - Intergenic
1113427030 13:110216714-110216736 CTAGTGACCCAGAAAAAACAGGG - Intronic
1114571297 14:23670920-23670942 ATAGTGAATGAGAAGGAACGTGG + Intergenic
1115522470 14:34246615-34246637 ATAGAGCCTGAGATAGAACAGGG - Intronic
1118095257 14:62529790-62529812 ATAATGACTCAGTCAGATCATGG - Intergenic
1118236186 14:64007530-64007552 TTAGTGGCTTAAAAAGAACACGG + Intronic
1118433557 14:65747739-65747761 TTAGAGACTCAGAAAGAGGAGGG + Intergenic
1119858189 14:77916715-77916737 ATAGTGAGGAAGAAAGAAGAGGG - Intronic
1119884198 14:78126618-78126640 AGCGTGGCACAGAAAGAACACGG - Intergenic
1119953148 14:78766736-78766758 ATAGTGTCTTGGAAAGAGCATGG + Intronic
1120102492 14:80461378-80461400 AGAGTAAAACAGAAAGAACAGGG + Intergenic
1120232231 14:81852380-81852402 TTAAGGACTCAGGAAGAACAAGG + Intergenic
1120719863 14:87879183-87879205 ATGATGACTCAGAAAGGCCAGGG + Intronic
1121142248 14:91553936-91553958 AAAGAGACTGAGAAAGAAGATGG - Intergenic
1121416135 14:93780362-93780384 ATAGTGAGAGAGAAGGAACAAGG - Intronic
1121491350 14:94363585-94363607 AGGGAGACTCAGAAACAACAGGG + Intergenic
1122608870 14:102967482-102967504 GTAGTGAAACAGCAAGAACACGG + Intronic
1123940695 15:25215214-25215236 ATACTGACTCATCAAGTACACGG - Intergenic
1124142726 15:27091664-27091686 GAAGTGACTCACAAAGAAAATGG - Intronic
1125127369 15:36239853-36239875 ATAGTGACTGGGGAAAAACACGG - Intergenic
1127339403 15:58025502-58025524 ATATTGAATCAGTAATAACAAGG + Intronic
1127912153 15:63426123-63426145 AAACTGACCCAGAAATAACACGG - Intergenic
1128173675 15:65534351-65534373 CTAGTGACTATGAGAGAACACGG + Intronic
1128247731 15:66144367-66144389 AAAGAGACGAAGAAAGAACAAGG - Intronic
1128917963 15:71583521-71583543 ATAGTGACTGTGAAAAAACAAGG - Intronic
1129165942 15:73777525-73777547 ACAGAGCCCCAGAAAGAACATGG - Intergenic
1130357705 15:83149470-83149492 AAAGAGACTAAGAAGGAACAGGG + Intronic
1130797760 15:87228743-87228765 ATTGTCACTCAGAAAGAAAACGG + Intergenic
1130868297 15:87950522-87950544 AAGGGGACTGAGAAAGAACATGG + Intronic
1131241860 15:90751725-90751747 CTAATGAGACAGAAAGAACAGGG - Intronic
1131797188 15:96031148-96031170 ATAGTGATTAACTAAGAACAAGG + Intergenic
1132278272 15:100589552-100589574 TTAAGGACTCAGAAAGGACAAGG - Intronic
1133147739 16:3802693-3802715 AGACTGACCAAGAAAGAACAAGG + Intronic
1135723786 16:24838908-24838930 CAAGTGACTCAGCAATAACACGG + Intergenic
1136281045 16:29211565-29211587 AAAGTTACTCGGAAAGAAAAAGG + Intergenic
1137367155 16:47870542-47870564 AGAGTGTTTCAGAAAAAACAGGG + Intergenic
1137962194 16:52893817-52893839 TTAAGGACTCAGAAAGGACAAGG - Intergenic
1138359314 16:56413618-56413640 AAAGTGACTCAGAATGGGCAGGG - Intronic
1138827521 16:60338538-60338560 ATACTGAGTTAGAAAGTACACGG + Intergenic
1140742781 16:77956325-77956347 ACAGAGACTCAGGAAGAAAAGGG + Intronic
1141253831 16:82382734-82382756 ATTGTTACTCAGAAACAGCACGG - Intergenic
1142085403 16:88177488-88177510 AAAGTTACTCGGAAAGAAAAAGG + Intergenic
1142951879 17:3489006-3489028 ATAAAGACTGGGAAAGAACATGG - Intronic
1143929714 17:10409421-10409443 ATAGTGAATCAGAGAGAAGTGGG + Exonic
1145221361 17:21092171-21092193 AGGGGGTCTCAGAAAGAACAGGG - Intergenic
1146781378 17:35676306-35676328 AGACTGACTTACAAAGAACAAGG - Intronic
1149116469 17:53103130-53103152 AGAGTGGCTCAGGAAGCACATGG - Intergenic
1151751413 17:76040486-76040508 ACAGGGATTCAGTAAGAACAAGG + Intronic
1152829864 17:82490639-82490661 GTGGTGGCTCAGAAAGCACAGGG - Intergenic
1154284643 18:13041031-13041053 ATTTTCACTCATAAAGAACACGG - Intronic
1156015325 18:32540886-32540908 ATAGTGCCTCATAAAGATTAAGG - Intergenic
1156073495 18:33242949-33242971 ATAGTGCCACAAAAAAAACATGG - Intronic
1156769830 18:40706783-40706805 ATAGAGATCGAGAAAGAACAAGG + Intergenic
1156928255 18:42609783-42609805 ATACTAACTGAGAAAGAAAATGG + Intergenic
1157330670 18:46701562-46701584 ATAGGGACACAGCAAGAAGAAGG + Intronic
1159603388 18:70450012-70450034 ATAAAGGCTCTGAAAGAACAGGG - Intergenic
1165001189 19:32763834-32763856 AGAGAGACTCAGAATGGACAGGG - Intronic
1166167513 19:41002469-41002491 ATAGTGAATAGAAAAGAACAGGG - Intronic
1166496312 19:43305494-43305516 AGAGAGACTGGGAAAGAACAGGG + Intergenic
1168430732 19:56277739-56277761 ATAGAGACTCAGAAGGAAGGAGG + Intronic
1168580565 19:57552494-57552516 AAAGTGAGTCAGAAACAACCAGG + Intronic
925920771 2:8636426-8636448 CTAATGACTCAGAAAGTCCAAGG + Intergenic
925981343 2:9179953-9179975 TTAGTGACTCAGGAAGGATATGG - Intergenic
927097733 2:19760414-19760436 ATTGTCACTCAGAAAGAGTAGGG - Intergenic
927274042 2:21246364-21246386 ATAGAAAATCAGAAACAACAGGG + Intergenic
927410668 2:22821940-22821962 ATACTTACTCAGAAATAAAAAGG + Intergenic
928843393 2:35638306-35638328 ATAGTTACTGATAAAGAAAAAGG - Intergenic
932754792 2:74399868-74399890 AGAGTGACTCAGAAAGTTAAGGG - Intergenic
938835391 2:135097552-135097574 ATAGTGACCAAGAAAGATCAGGG - Intronic
939307071 2:140425714-140425736 ATAGTCACCCAGACAGAAAATGG - Intronic
939465727 2:142553375-142553397 ATATTGAAGCAGAAAGAATATGG + Intergenic
939974742 2:148704591-148704613 ACTGTGACTCATCAAGAACAGGG - Intronic
940927783 2:159385994-159386016 ACAGTGATTGAGAGAGAACAAGG + Intronic
945192372 2:207202731-207202753 ATAGTAACTCAGTAAGGACCGGG + Intergenic
945880459 2:215319800-215319822 ATAGTGAGTAAGAAAACACAGGG - Intronic
946706031 2:222459778-222459800 ATGGTGAATCAGGAAGAGCATGG - Intronic
947230708 2:227883086-227883108 AGAGTGACTGAGAAACAACATGG + Intronic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
1172082407 20:32352447-32352469 ACAGTGCCTTAGAAAGAACTTGG + Intergenic
1172340846 20:34156204-34156226 AGAGGGAGTCAGAAAGAAAAGGG + Intergenic
1173481061 20:43399707-43399729 ATAAAGGCTCTGAAAGAACAGGG - Intergenic
1173733516 20:45344314-45344336 ACAGTGACTCCCAAAGGACAAGG + Intronic
1177062173 21:16389428-16389450 GTAGTCACTAAGAAAGAAAATGG - Intergenic
1177096957 21:16847790-16847812 CTAGTGTCTCAGAAAGAAGGAGG - Intergenic
1177256785 21:18673637-18673659 ATAATGATAAAGAAAGAACATGG - Intergenic
1177972391 21:27806794-27806816 ATAGTTACTCAAAAAGAATTTGG - Intergenic
1178700475 21:34829149-34829171 ATAGTGGCTAAGAAAGAATGAGG - Intronic
1178910067 21:36667140-36667162 ACAGTGGCTCAGAGAGAGCACGG - Intergenic
1179347415 21:40572639-40572661 ATAGTAACCCAGAGAGAAAAAGG + Intronic
1179644792 21:42768886-42768908 AATGTGTCTCAGTAAGAACAAGG - Intronic
1181430999 22:22881723-22881745 TTAGTGTCTCAGAAGGCACAGGG + Intronic
1182056193 22:27356930-27356952 ATTGTTACTCAGAAAGAAGAAGG + Intergenic
1185289997 22:50018881-50018903 AAAGTGGTTCAGAATGAACATGG + Intronic
949456837 3:4247911-4247933 ATTGAGACTCAGAGAGATCAAGG - Intronic
950292486 3:11796740-11796762 AAAAGGACTCATAAAGAACAAGG + Intronic
954052155 3:47988786-47988808 ATAGTTTCACAGAAAGAACAGGG + Intronic
954989551 3:54828829-54828851 ATAATGATTCAGTAAGAAGAGGG + Intronic
956927992 3:74010086-74010108 ATAGTGAGTCAGAAAAAACTGGG - Intergenic
958920956 3:100104758-100104780 AGAGAAACTCAGAAAAAACAGGG + Intronic
962399745 3:135048181-135048203 AAAGAGACTCAGACAGAAAAGGG - Intronic
963007995 3:140744133-140744155 AGAGGGGCTCAGAAAGATCATGG + Intergenic
963398871 3:144771304-144771326 ATAGTGGAGGAGAAAGAACAGGG - Intergenic
965460600 3:168957291-168957313 ATTGTCACTCACAAAGAGCAGGG + Intergenic
966361924 3:179138993-179139015 AGATTGAACCAGAAAGAACATGG + Intergenic
966993461 3:185256769-185256791 TTAAGGACTCAGGAAGAACAAGG + Intronic
967368447 3:188715085-188715107 ATAGATACTTAAAAAGAACAAGG + Intronic
971045460 4:22800895-22800917 ATAGGGTCTTAGAAAGAGCATGG + Intergenic
971192397 4:24440062-24440084 ATAGGGACTCAGAGAAAAGAAGG - Intergenic
971589601 4:28450527-28450549 AAAGTCACTCATAAAGATCAGGG - Intergenic
972957614 4:44411865-44411887 TCAGGGTCTCAGAAAGAACAAGG + Intronic
973035379 4:45399128-45399150 TTAAGGACTCAGAAAAAACAAGG + Intergenic
973072755 4:45885397-45885419 ATAGTGATGCAGTAAGTACATGG + Intergenic
973194340 4:47422521-47422543 ATAGTGTTTCAGAGAGAACAGGG - Intronic
974490058 4:62553146-62553168 TTAGAGACTCAGAAAGGAGAGGG - Intergenic
974962980 4:68726646-68726668 TTAGAGACTCAGAAAGGAGAGGG - Intergenic
975665436 4:76730445-76730467 ATAGAGACCAAGAAAGACCAAGG + Intronic
976132634 4:81901001-81901023 ATAGTGAATAAGAAAGACGAGGG - Intronic
977265935 4:94854428-94854450 TCAGTGACTCAGAAACAACAAGG + Intronic
977284326 4:95083331-95083353 ATAAAGACACAGAAAGATCATGG + Intronic
978575368 4:110184578-110184600 TCAGTGACTCAGAAAGACAATGG + Intronic
979238855 4:118430823-118430845 GTAGAGCCACAGAAAGAACATGG - Intergenic
980955381 4:139423212-139423234 ATAGTAGCTCAGAAAAAGCAAGG - Intergenic
982937769 4:161506061-161506083 ATCCTGCCTCAGAAATAACAGGG - Intronic
983132537 4:164039347-164039369 AAAGTTACACAGAAAGAACCTGG + Intronic
983393562 4:167164745-167164767 ATAATGACCTTGAAAGAACATGG - Intronic
983466745 4:168102581-168102603 ACAGTGACTCAGCAATAAAATGG - Intronic
984104270 4:175525456-175525478 ATGTCAACTCAGAAAGAACATGG - Intergenic
984390839 4:179130048-179130070 AGAGTTAATCAGAAAGATCATGG + Intergenic
984447296 4:179853049-179853071 ATAGCGACTAAGAAAGCAAAGGG + Intergenic
984782442 4:183538184-183538206 ATCGAGACTCATAAAGAATAAGG - Intergenic
986064920 5:4225883-4225905 CTAGGGACACAGAGAGAACACGG - Intergenic
991692169 5:69235744-69235766 ACAGTGACCTAGAAAGATCATGG - Intronic
992142557 5:73813533-73813555 GTAGAGACTCAGGAAGAACTCGG - Intronic
992595099 5:78338165-78338187 AAAGTGACTCATCAAGTACAAGG - Intergenic
993358578 5:86944906-86944928 TTAATGACTCATAAAGAAAAAGG + Intergenic
993651131 5:90523933-90523955 ATAATGACACAGAGAGAAAATGG + Intronic
994159910 5:96545951-96545973 TCAGTGACTTAGAAGGAACAAGG - Intronic
994760276 5:103843392-103843414 ATAGTGAGAAAGAAAGAAAATGG - Intergenic
995325465 5:110885116-110885138 TTAAGGACTCAGGAAGAACAAGG - Intergenic
995705270 5:114982326-114982348 ATGGTGAGGCAGAAAGAACCTGG + Intergenic
996167930 5:120248893-120248915 ATAGTAAATCAGTAAGAATATGG + Intergenic
996194324 5:120584973-120584995 CTAGTGAGGCAGAAAGACCAGGG - Intronic
997008905 5:129853412-129853434 ATATTATCTGAGAAAGAACAAGG + Intergenic
998062147 5:139127143-139127165 AGTGTGGCCCAGAAAGAACAGGG + Intronic
998310520 5:141124829-141124851 ATAGTCAACCAGAAAGGACAAGG - Exonic
998404660 5:141867569-141867591 AAAGAGACTGAGAAAGAAAAGGG - Intronic
998561304 5:143174259-143174281 ATAGCCACTAAGAAAGAACGAGG + Intronic
999831508 5:155324630-155324652 ATGGTGACTCAGAGAGATCCTGG - Intergenic
999862394 5:155662482-155662504 GAAGTTAATCAGAAAGAACAAGG + Intergenic
1000112343 5:158120931-158120953 AAGGTGACTCAGAAGGAATAGGG + Intergenic
1000422185 5:161050942-161050964 CTAGTGACTGGGAAGGAACATGG + Intergenic
1001197059 5:169682970-169682992 ATACTGACTCAGTAATAAAAAGG - Intronic
1001577477 5:172773577-172773599 ACAGTGAATCATAAAGAGCAGGG - Intergenic
1003462871 6:6348294-6348316 AGAATGCCTCAGAAACAACAGGG - Intergenic
1003482002 6:6543042-6543064 ATAGTTACTAGGCAAGAACAGGG - Intergenic
1003762762 6:9198908-9198930 CTGGTGACTCAGCAAGAAGAGGG - Intergenic
1003883850 6:10503036-10503058 ATACTGAATCAGCAAGAGCAGGG - Intronic
1004313527 6:14566301-14566323 CTAATGACTAAGAAAGACCATGG + Intergenic
1004798951 6:19123884-19123906 ATAATGACTCAGAAAGTGCTGGG + Intergenic
1004877638 6:19971706-19971728 ATAGGAACTCAGTAAGAACTGGG + Intergenic
1005123309 6:22415692-22415714 ATAGTAACTCTCCAAGAACATGG + Intergenic
1006670384 6:35726639-35726661 ATAGGGACTCAGAAGAAAGAAGG - Intronic
1007812693 6:44497546-44497568 TTTGTGATGCAGAAAGAACAAGG - Intergenic
1008169902 6:48191287-48191309 ATACTGTTTCATAAAGAACAAGG - Intergenic
1008660121 6:53659217-53659239 ATAGTGACTCAGAAAAGAAGTGG + Intronic
1008748938 6:54708762-54708784 ATAGTTACTCAGAACAAGCATGG + Intergenic
1009350257 6:62666781-62666803 AGAGAGACACAGAAAGAAGAAGG + Intergenic
1010357692 6:74953645-74953667 ATAGTGACTGAGACAAAGCATGG - Intergenic
1010706612 6:79120602-79120624 AGAGTGATTCAGTAAGAACACGG + Intergenic
1011580817 6:88862212-88862234 ATGGGGACTAGGAAAGAACATGG + Intronic
1013028539 6:106306172-106306194 ATACTGACAAAGTAAGAACATGG + Intronic
1013866173 6:114698917-114698939 ATTGAGACATAGAAAGAACATGG + Intergenic
1014256621 6:119166825-119166847 ATAATGATTATGAAAGAACATGG + Intergenic
1014315625 6:119861211-119861233 AGTTTGAATCAGAAAGAACAAGG - Intergenic
1015509302 6:134022153-134022175 ATATAGAAGCAGAAAGAACATGG + Intronic
1016854594 6:148654547-148654569 TTAAGGACTCAGGAAGAACAAGG - Intergenic
1018190187 6:161303814-161303836 ATAGTGAGTCAACAAGAAAAAGG - Intergenic
1020378599 7:7516228-7516250 ATAGAGACTCTGAAAGAAATTGG + Intronic
1020966944 7:14882596-14882618 ATAGAGACTCAGAAGGGAGAAGG - Intronic
1021200967 7:17728305-17728327 AAAGCTACCCAGAAAGAACAGGG - Intergenic
1024345823 7:48311822-48311844 TGAGTGAATCAGAAAGTACATGG - Intronic
1024922034 7:54568176-54568198 ATAGTGACTTTTAGAGAACAAGG + Intronic
1024974589 7:55101362-55101384 ATAGAGCGACAGAAAGAACACGG - Intronic
1029973245 7:104810110-104810132 TCAGTGACTCAGAGAGAGCATGG + Intronic
1032183705 7:129704887-129704909 ATAAGGACTCAGAAACATCATGG - Intronic
1032496409 7:132366196-132366218 ATCAAGACTCAGAAAGCACAGGG - Intronic
1032799038 7:135303389-135303411 ATAGTGACAAAGAAGGAAGAGGG + Intergenic
1033444613 7:141409358-141409380 TGAGTGTCTCAGGAAGAACAAGG + Intronic
1033605614 7:142926134-142926156 ATAATGACTGAGGAAGAACAGGG + Intronic
1033844168 7:145412295-145412317 ATAGTTACATAGAATGAACAAGG - Intergenic
1034473209 7:151267410-151267432 ATAGTGACTCAGAAAGAACACGG - Intronic
1034940247 7:155226088-155226110 AGAGTGAGACAGAGAGAACAAGG + Intergenic
1035922937 8:3697835-3697857 ATAGTGAATGAGAAACAACCTGG - Intronic
1037351443 8:17962437-17962459 ATATTTACTAACAAAGAACATGG - Intronic
1038399622 8:27273117-27273139 ATGGTGTCTCAGAAAGAGGAGGG + Intergenic
1038642873 8:29341569-29341591 ACTGTGACTCAGCAGGAACAAGG - Intronic
1038945041 8:32349836-32349858 ACAGAGAATCAGAAAGAAGATGG - Intronic
1039675446 8:39660422-39660444 ATAGTAACCGAAAAAGAACAGGG + Intronic
1040717748 8:50278396-50278418 TTACTGAGGCAGAAAGAACAAGG - Intronic
1041430859 8:57779156-57779178 ACAGTGACTCAGCAAGTCCAAGG - Intergenic
1041478574 8:58293043-58293065 ATTATGACTGAAAAAGAACAAGG - Intergenic
1043211097 8:77519128-77519150 ATAAACACACAGAAAGAACAAGG - Intergenic
1043468319 8:80536200-80536222 ACAGTGACTTAGAAATATCAGGG - Intergenic
1043825084 8:84917611-84917633 ACAGTGAATCAGAAAACACAGGG - Intronic
1044133377 8:88555004-88555026 AAAGTGACTGCTAAAGAACATGG - Intergenic
1044505503 8:93012890-93012912 GTATTGAATCAGAAACAACAAGG + Intronic
1045601133 8:103718374-103718396 ACAATGACTGAGAAAAAACAGGG - Intronic
1047611762 8:126527936-126527958 ATAGGCACTCAGAAAAAAAATGG - Intergenic
1048188947 8:132270989-132271011 TTAGTGACTAAGAAAAGACAAGG + Intronic
1048969293 8:139635445-139635467 ATAATTACTCTGAAATAACAGGG + Intronic
1049713303 8:144077280-144077302 ACGATGACTCAGTAAGAACAGGG + Intergenic
1050818091 9:9840584-9840606 ATAGTGAATCGGAAAGAAATGGG + Intronic
1050876140 9:10639306-10639328 ATAGTGAACCAGAAAAAGCAAGG + Intergenic
1051439491 9:17069057-17069079 AAAGGAACTCAGGAAGAACAGGG + Intergenic
1053103289 9:35389668-35389690 ATAGTCACTCTTACAGAACAGGG + Intronic
1056280490 9:85037210-85037232 AAAGTGAGTCAGAAAGAAAGTGG - Intergenic
1056533750 9:87509950-87509972 ATAGTGACTTAGTCAGAAAAAGG - Intronic
1059683031 9:116604868-116604890 ACAGGGACAGAGAAAGAACAGGG + Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060370180 9:123061774-123061796 ATGGTGACTTTAAAAGAACACGG - Intronic
1060419250 9:123455692-123455714 AGAGTGAGACAGAAAGAAAATGG + Intronic
1061250029 9:129421168-129421190 CCAGTGACACAGAAAGACCAGGG - Intergenic
1203433129 Un_GL000195v1:110083-110105 GTAGTGCTTCAGAAAAAACAAGG - Intergenic
1186102559 X:6172544-6172566 ATAGTGACTCATAAAAAACATGG - Intronic
1186714462 X:12235753-12235775 TTAGAGTCTCAGAAAGAACATGG + Intronic
1186845271 X:13524561-13524583 ATAATGACACAGAAAGAGAAGGG - Intergenic
1187468437 X:19546816-19546838 ACAGTGAGGCAGAAAGAACAGGG - Intronic
1187678293 X:21740110-21740132 ATATTGACTCAGGAAGAAGGGGG + Intronic
1187968385 X:24635506-24635528 TTAGTGACTCAGAAAAAAAGAGG - Intronic
1188033799 X:25294354-25294376 ATTGTGAGTCATAAAGATCATGG - Intergenic
1189042779 X:37560476-37560498 AGAATCATTCAGAAAGAACAAGG + Intronic
1189945505 X:46173463-46173485 ACAGTGTCTTAGAAAGAAAAAGG + Intergenic
1195558803 X:106259083-106259105 TTAGGGACTCAGGAAGGACAAGG + Intergenic
1196996617 X:121390482-121390504 ACAGTGAGTCAGTAACAACAAGG - Intergenic
1197078821 X:122387498-122387520 ATAGGCACTCATAAAGAATATGG + Intergenic
1197326064 X:125095090-125095112 AAAGTGACTCAGCTAGAAAATGG + Intergenic
1197522450 X:127516171-127516193 AGAATGAGTCAGAAAGAAAAAGG - Intergenic
1197564699 X:128067936-128067958 ATAATGACTCATCATGAACAAGG + Intergenic
1198949727 X:142057122-142057144 TTCGGGACTCAGAAAGGACAAGG + Intergenic
1200755654 Y:6987732-6987754 AAAGCCACTCAGAAAGAAAAAGG - Intronic
1201233062 Y:11884331-11884353 TGAGTGACTCAGACAGCACAGGG - Intergenic
1202386612 Y:24332631-24332653 GTAGAGCCACAGAAAGAACATGG - Intergenic
1202484173 Y:25337497-25337519 GTAGAGCCACAGAAAGAACATGG + Intergenic