ID: 1034474603

View in Genome Browser
Species Human (GRCh38)
Location 7:151275277-151275299
Sequence GCCTCCTTGAATCTACGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 56}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034474603_1034474609 10 Left 1034474603 7:151275277-151275299 CCCCAGCGTAGATTCAAGGAGGC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1034474609 7:151275310-151275332 TGCGAAGAAGCCAAACTCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 110
1034474603_1034474610 15 Left 1034474603 7:151275277-151275299 CCCCAGCGTAGATTCAAGGAGGC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1034474610 7:151275315-151275337 AGAAGCCAAACTCCCCGGAGTGG No data
1034474603_1034474613 25 Left 1034474603 7:151275277-151275299 CCCCAGCGTAGATTCAAGGAGGC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1034474613 7:151275325-151275347 CTCCCCGGAGTGGAGGTCTGAGG 0: 1
1: 0
2: 0
3: 18
4: 184
1034474603_1034474611 18 Left 1034474603 7:151275277-151275299 CCCCAGCGTAGATTCAAGGAGGC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1034474611 7:151275318-151275340 AGCCAAACTCCCCGGAGTGGAGG 0: 1
1: 1
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034474603 Original CRISPR GCCTCCTTGAATCTACGCTG GGG (reversed) Intronic
910734282 1:90435038-90435060 GCCTCCTTAAAGCTACCCTAAGG - Intergenic
911222219 1:95261321-95261343 GCATCCTTGAATCCAAGCTAGGG + Intergenic
914365525 1:146974757-146974779 ACCTCCTAAAATCTATGCTGAGG + Exonic
1063188123 10:3668584-3668606 GCCCCCTTGCATCTGCCCTGGGG + Intergenic
1070384656 10:75913613-75913635 ACCTCCTTGAGGCTAGGCTGAGG + Intronic
1073988896 10:109240912-109240934 GCCTCCTTAAATTCATGCTGAGG - Intergenic
1077089184 11:770732-770754 GCCTCCTGGAATCAGCTCTGAGG - Exonic
1084902505 11:72320271-72320293 GCCTCCCTGAGTCTTCTCTGGGG + Intronic
1085356387 11:75842017-75842039 GCCTGCTGGAATCTCAGCTGGGG + Intronic
1085392474 11:76189505-76189527 GCCTCCTCAAATCTAACCTGGGG - Intronic
1087121253 11:94576509-94576531 CCCTCCTGGATTCTACCCTGGGG + Intronic
1094386147 12:29895933-29895955 GCTTGCTTGAATCATCGCTGTGG + Intergenic
1100167372 12:91931305-91931327 TTCTCCTTGAATTTACCCTGGGG - Intergenic
1112946073 13:104928588-104928610 TCCTCTTTGAATTTACACTGAGG - Intergenic
1113596410 13:111537229-111537251 GTCTCCTTGTTTCTGCGCTGAGG + Intergenic
1115131852 14:30063232-30063254 GCCTTCTGGAATCTACTCTGGGG - Intronic
1119481922 14:74963323-74963345 GCCACCTTGAAGACACGCTGGGG - Intergenic
1121962545 14:98274824-98274846 GCCTCCCTTAATCTGTGCTGTGG + Intergenic
1123142180 14:106090996-106091018 GCCTCTTCGAATCTATTCTGGGG + Intergenic
1133062082 16:3181667-3181689 GCCTCCTCACATCTACTCTGAGG - Intergenic
1138475465 16:57268359-57268381 GACTCCTTGAATTCACGCTCTGG + Intronic
1143772713 17:9178796-9178818 GCCTCCCTGAAGCTAGGCGGTGG - Intronic
1144575470 17:16426917-16426939 GCCTGCTTGAAACAACCCTGGGG + Intronic
1151563275 17:74882446-74882468 GCCTCCATGAAGCCACGCAGGGG + Intronic
1152361887 17:79836660-79836682 GCCTCCTTGGACCAACCCTGGGG + Intronic
1154476928 18:14769674-14769696 GTCTCCATCAATCTATGCTGAGG - Intronic
1160943756 19:1631797-1631819 GCCTCCCTGCCTCTACGCTCAGG + Intronic
1164916861 19:32058812-32058834 GCCTCATAGAATCTATGGTGAGG - Intergenic
926375152 2:12219885-12219907 GCCTCCTTGAATCTGTGTTATGG + Intergenic
936915057 2:117631756-117631778 GCCACCTTGAATTTAAGCTTCGG + Intergenic
1171400291 20:24868765-24868787 GCCTCCTGGTATCTATGCTTCGG - Intergenic
1178520824 21:33287294-33287316 GCCTGCTAGAAGCTATGCTGGGG + Intronic
1179975571 21:44863956-44863978 GCCTCCTCAAACCTACGCTACGG + Intronic
1185223405 22:49640203-49640225 GCCTCCTGGAAGCTAGGCTGGGG - Intronic
954609786 3:51938188-51938210 GCTTCCTTGGAGCTAGGCTGTGG + Exonic
954865373 3:53724617-53724639 GCTCCCCTGACTCTACGCTGAGG + Intronic
965376059 3:167925995-167926017 TCCTCCTTGAATTTTGGCTGGGG + Intergenic
970338651 4:15081523-15081545 GCCTCCTTGAATGAACACTCTGG - Intergenic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
977017062 4:91704655-91704677 GCCACCTTAAATCTACTCTTAGG + Intergenic
978323336 4:107522758-107522780 GCCTCCTAGAATCCATGCAGAGG - Intergenic
982664944 4:158250628-158250650 GACCCCTTGCATCTATGCTGGGG + Intronic
986219949 5:5759125-5759147 CCCTACTTGAATATACTCTGAGG + Intergenic
988496753 5:31751848-31751870 GCCTCTTTGAAGCTGGGCTGGGG + Intronic
992827239 5:80562540-80562562 GCCTCCTCGAAGCCAAGCTGGGG - Intronic
1008058589 6:46972856-46972878 GCCTGCTTGCTTCTATGCTGAGG + Intergenic
1013803309 6:113970888-113970910 GCCTCCTTGACTGTACGCCATGG + Exonic
1015182593 6:130377195-130377217 GACTCCCTGAGTCTACGTTGGGG + Intronic
1018475038 6:164132078-164132100 GCCTCTATGCATCTATGCTGGGG + Intergenic
1019559439 7:1648596-1648618 GCCTTCCTGACTCCACGCTGGGG - Intergenic
1027250448 7:76395464-76395486 GCCTCCTTGGAACCCCGCTGCGG - Intronic
1030639354 7:111986484-111986506 ACTTCCTTGATTCTACTCTGTGG - Intronic
1034474603 7:151275277-151275299 GCCTCCTTGAATCTACGCTGGGG - Intronic
1036750264 8:11439464-11439486 GCCCCCTCGAAGCCACGCTGTGG + Intronic
1050057655 9:1672386-1672408 GCCTACTTGAATCATGGCTGGGG + Intergenic
1057331636 9:94120665-94120687 GCCTGCTTGAATCAGAGCTGGGG - Intergenic
1061306140 9:129734453-129734475 GCCTCCCTGAATCGAGGCTCTGG + Intergenic
1191063018 X:56319000-56319022 GCCTCCATGAATCAAGGCTAAGG + Intergenic
1196815250 X:119660383-119660405 GCCTCCTTGAAATTGCACTGAGG - Intronic