ID: 1034478404

View in Genome Browser
Species Human (GRCh38)
Location 7:151302065-151302087
Sequence AGGGCAGGTCTGAGGATTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034478404_1034478414 24 Left 1034478404 7:151302065-151302087 CCTTGAATCCTCAGACCTGCCCT No data
Right 1034478414 7:151302112-151302134 ATCTGCGTCCAAGAAAGGTGAGG No data
1034478404_1034478413 19 Left 1034478404 7:151302065-151302087 CCTTGAATCCTCAGACCTGCCCT No data
Right 1034478413 7:151302107-151302129 CCAAGATCTGCGTCCAAGAAAGG No data
1034478404_1034478408 -6 Left 1034478404 7:151302065-151302087 CCTTGAATCCTCAGACCTGCCCT No data
Right 1034478408 7:151302082-151302104 TGCCCTTGGTGCCACTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034478404 Original CRISPR AGGGCAGGTCTGAGGATTCA AGG (reversed) Intergenic