ID: 1034478408

View in Genome Browser
Species Human (GRCh38)
Location 7:151302082-151302104
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034478404_1034478408 -6 Left 1034478404 7:151302065-151302087 CCTTGAATCCTCAGACCTGCCCT No data
Right 1034478408 7:151302082-151302104 TGCCCTTGGTGCCACTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034478408 Original CRISPR TGCCCTTGGTGCCACTGTAC TGG Intergenic
No off target data available for this crispr