ID: 1034478493

View in Genome Browser
Species Human (GRCh38)
Location 7:151302562-151302584
Sequence TGGATAACAGGTCCCTTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034478493_1034478502 16 Left 1034478493 7:151302562-151302584 CCCAAGAAGGGACCTGTTATCCA No data
Right 1034478502 7:151302601-151302623 CCGGCTGACCGAGTAATGTTTGG No data
1034478493_1034478498 -3 Left 1034478493 7:151302562-151302584 CCCAAGAAGGGACCTGTTATCCA No data
Right 1034478498 7:151302582-151302604 CCACGGCACCACTCACCGTCCGG No data
1034478493_1034478504 28 Left 1034478493 7:151302562-151302584 CCCAAGAAGGGACCTGTTATCCA No data
Right 1034478504 7:151302613-151302635 GTAATGTTTGGAGACAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034478493 Original CRISPR TGGATAACAGGTCCCTTCTT GGG (reversed) Intergenic