ID: 1034478498 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:151302582-151302604 |
Sequence | CCACGGCACCACTCACCGTC CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1034478493_1034478498 | -3 | Left | 1034478493 | 7:151302562-151302584 | CCCAAGAAGGGACCTGTTATCCA | No data | ||
Right | 1034478498 | 7:151302582-151302604 | CCACGGCACCACTCACCGTCCGG | No data | ||||
1034478494_1034478498 | -4 | Left | 1034478494 | 7:151302563-151302585 | CCAAGAAGGGACCTGTTATCCAC | No data | ||
Right | 1034478498 | 7:151302582-151302604 | CCACGGCACCACTCACCGTCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1034478498 | Original CRISPR | CCACGGCACCACTCACCGTC CGG | Intergenic | ||