ID: 1034478498

View in Genome Browser
Species Human (GRCh38)
Location 7:151302582-151302604
Sequence CCACGGCACCACTCACCGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034478493_1034478498 -3 Left 1034478493 7:151302562-151302584 CCCAAGAAGGGACCTGTTATCCA No data
Right 1034478498 7:151302582-151302604 CCACGGCACCACTCACCGTCCGG No data
1034478494_1034478498 -4 Left 1034478494 7:151302563-151302585 CCAAGAAGGGACCTGTTATCCAC No data
Right 1034478498 7:151302582-151302604 CCACGGCACCACTCACCGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034478498 Original CRISPR CCACGGCACCACTCACCGTC CGG Intergenic
No off target data available for this crispr