ID: 1034478502

View in Genome Browser
Species Human (GRCh38)
Location 7:151302601-151302623
Sequence CCGGCTGACCGAGTAATGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034478494_1034478502 15 Left 1034478494 7:151302563-151302585 CCAAGAAGGGACCTGTTATCCAC No data
Right 1034478502 7:151302601-151302623 CCGGCTGACCGAGTAATGTTTGG No data
1034478497_1034478502 -4 Left 1034478497 7:151302582-151302604 CCACGGCACCACTCACCGTCCGG No data
Right 1034478502 7:151302601-151302623 CCGGCTGACCGAGTAATGTTTGG No data
1034478493_1034478502 16 Left 1034478493 7:151302562-151302584 CCCAAGAAGGGACCTGTTATCCA No data
Right 1034478502 7:151302601-151302623 CCGGCTGACCGAGTAATGTTTGG No data
1034478496_1034478502 4 Left 1034478496 7:151302574-151302596 CCTGTTATCCACGGCACCACTCA No data
Right 1034478502 7:151302601-151302623 CCGGCTGACCGAGTAATGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034478502 Original CRISPR CCGGCTGACCGAGTAATGTT TGG Intergenic
No off target data available for this crispr