ID: 1034478504

View in Genome Browser
Species Human (GRCh38)
Location 7:151302613-151302635
Sequence GTAATGTTTGGAGACAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034478493_1034478504 28 Left 1034478493 7:151302562-151302584 CCCAAGAAGGGACCTGTTATCCA No data
Right 1034478504 7:151302613-151302635 GTAATGTTTGGAGACAAGAGAGG No data
1034478494_1034478504 27 Left 1034478494 7:151302563-151302585 CCAAGAAGGGACCTGTTATCCAC No data
Right 1034478504 7:151302613-151302635 GTAATGTTTGGAGACAAGAGAGG No data
1034478496_1034478504 16 Left 1034478496 7:151302574-151302596 CCTGTTATCCACGGCACCACTCA No data
Right 1034478504 7:151302613-151302635 GTAATGTTTGGAGACAAGAGAGG No data
1034478497_1034478504 8 Left 1034478497 7:151302582-151302604 CCACGGCACCACTCACCGTCCGG No data
Right 1034478504 7:151302613-151302635 GTAATGTTTGGAGACAAGAGAGG No data
1034478500_1034478504 -7 Left 1034478500 7:151302597-151302619 CCGTCCGGCTGACCGAGTAATGT No data
Right 1034478504 7:151302613-151302635 GTAATGTTTGGAGACAAGAGAGG No data
1034478499_1034478504 0 Left 1034478499 7:151302590-151302612 CCACTCACCGTCCGGCTGACCGA No data
Right 1034478504 7:151302613-151302635 GTAATGTTTGGAGACAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034478504 Original CRISPR GTAATGTTTGGAGACAAGAG AGG Intergenic
No off target data available for this crispr