ID: 1034478510

View in Genome Browser
Species Human (GRCh38)
Location 7:151302635-151302657
Sequence GTCCCCAAGTGGGGAGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034478501_1034478510 11 Left 1034478501 7:151302601-151302623 CCGGCTGACCGAGTAATGTTTGG No data
Right 1034478510 7:151302635-151302657 GTCCCCAAGTGGGGAGGGTGTGG No data
1034478500_1034478510 15 Left 1034478500 7:151302597-151302619 CCGTCCGGCTGACCGAGTAATGT No data
Right 1034478510 7:151302635-151302657 GTCCCCAAGTGGGGAGGGTGTGG No data
1034478499_1034478510 22 Left 1034478499 7:151302590-151302612 CCACTCACCGTCCGGCTGACCGA No data
Right 1034478510 7:151302635-151302657 GTCCCCAAGTGGGGAGGGTGTGG No data
1034478497_1034478510 30 Left 1034478497 7:151302582-151302604 CCACGGCACCACTCACCGTCCGG No data
Right 1034478510 7:151302635-151302657 GTCCCCAAGTGGGGAGGGTGTGG No data
1034478503_1034478510 3 Left 1034478503 7:151302609-151302631 CCGAGTAATGTTTGGAGACAAGA No data
Right 1034478510 7:151302635-151302657 GTCCCCAAGTGGGGAGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034478510 Original CRISPR GTCCCCAAGTGGGGAGGGTG TGG Intergenic