ID: 1034479079

View in Genome Browser
Species Human (GRCh38)
Location 7:151306032-151306054
Sequence AGATGTAATAGGAAGGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034479079_1034479083 -5 Left 1034479079 7:151306032-151306054 CCTTCAGCCTTCCTATTACATCT No data
Right 1034479083 7:151306050-151306072 CATCTATCTATATGTAGGATTGG No data
1034479079_1034479082 -10 Left 1034479079 7:151306032-151306054 CCTTCAGCCTTCCTATTACATCT No data
Right 1034479082 7:151306045-151306067 TATTACATCTATCTATATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034479079 Original CRISPR AGATGTAATAGGAAGGCTGA AGG (reversed) Intergenic
No off target data available for this crispr