ID: 1034479618

View in Genome Browser
Species Human (GRCh38)
Location 7:151309249-151309271
Sequence GCTGGCCCAGCGGGTGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034479607_1034479618 20 Left 1034479607 7:151309206-151309228 CCCAGGTTCATTCCCAGCGCTCT No data
Right 1034479618 7:151309249-151309271 GCTGGCCCAGCGGGTGCTCAGGG No data
1034479605_1034479618 25 Left 1034479605 7:151309201-151309223 CCTACCCCAGGTTCATTCCCAGC No data
Right 1034479618 7:151309249-151309271 GCTGGCCCAGCGGGTGCTCAGGG No data
1034479608_1034479618 19 Left 1034479608 7:151309207-151309229 CCAGGTTCATTCCCAGCGCTCTG No data
Right 1034479618 7:151309249-151309271 GCTGGCCCAGCGGGTGCTCAGGG No data
1034479606_1034479618 21 Left 1034479606 7:151309205-151309227 CCCCAGGTTCATTCCCAGCGCTC No data
Right 1034479618 7:151309249-151309271 GCTGGCCCAGCGGGTGCTCAGGG No data
1034479611_1034479618 7 Left 1034479611 7:151309219-151309241 CCAGCGCTCTGGTCTGCTCTGTG No data
Right 1034479618 7:151309249-151309271 GCTGGCCCAGCGGGTGCTCAGGG No data
1034479603_1034479618 29 Left 1034479603 7:151309197-151309219 CCACCCTACCCCAGGTTCATTCC No data
Right 1034479618 7:151309249-151309271 GCTGGCCCAGCGGGTGCTCAGGG No data
1034479604_1034479618 26 Left 1034479604 7:151309200-151309222 CCCTACCCCAGGTTCATTCCCAG No data
Right 1034479618 7:151309249-151309271 GCTGGCCCAGCGGGTGCTCAGGG No data
1034479602_1034479618 30 Left 1034479602 7:151309196-151309218 CCCACCCTACCCCAGGTTCATTC No data
Right 1034479618 7:151309249-151309271 GCTGGCCCAGCGGGTGCTCAGGG No data
1034479610_1034479618 8 Left 1034479610 7:151309218-151309240 CCCAGCGCTCTGGTCTGCTCTGT No data
Right 1034479618 7:151309249-151309271 GCTGGCCCAGCGGGTGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034479618 Original CRISPR GCTGGCCCAGCGGGTGCTCA GGG Intergenic