ID: 1034482404

View in Genome Browser
Species Human (GRCh38)
Location 7:151332611-151332633
Sequence CAGTCTTGGGGGAAGGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034482392_1034482404 15 Left 1034482392 7:151332573-151332595 CCTAATTAAAAAGTTGAGACTTT No data
Right 1034482404 7:151332611-151332633 CAGTCTTGGGGGAAGGCAACAGG No data
1034482391_1034482404 21 Left 1034482391 7:151332567-151332589 CCAAGGCCTAATTAAAAAGTTGA No data
Right 1034482404 7:151332611-151332633 CAGTCTTGGGGGAAGGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034482404 Original CRISPR CAGTCTTGGGGGAAGGCAAC AGG Intergenic
No off target data available for this crispr