ID: 1034485504

View in Genome Browser
Species Human (GRCh38)
Location 7:151358622-151358644
Sequence TTTTCCATGGACAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 663
Summary {0: 1, 1: 3, 2: 16, 3: 89, 4: 554}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034485504_1034485510 18 Left 1034485504 7:151358622-151358644 CCTTCCTCCTTGTCCATGGAAAA 0: 1
1: 3
2: 16
3: 89
4: 554
Right 1034485510 7:151358663-151358685 AGTCCCTAGTGCCAAAAGGTTGG 0: 2
1: 13
2: 58
3: 99
4: 190
1034485504_1034485509 14 Left 1034485504 7:151358622-151358644 CCTTCCTCCTTGTCCATGGAAAA 0: 1
1: 3
2: 16
3: 89
4: 554
Right 1034485509 7:151358659-151358681 AAGCAGTCCCTAGTGCCAAAAGG No data
1034485504_1034485511 19 Left 1034485504 7:151358622-151358644 CCTTCCTCCTTGTCCATGGAAAA 0: 1
1: 3
2: 16
3: 89
4: 554
Right 1034485511 7:151358664-151358686 GTCCCTAGTGCCAAAAGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034485504 Original CRISPR TTTTCCATGGACAAGGAGGA AGG (reversed) Intronic
900849674 1:5132592-5132614 TTATCCATGGACAAGCTGTAAGG + Intergenic
901165975 1:7221819-7221841 TATCCCATGGTCAGGGAGGATGG + Intronic
901610415 1:10493710-10493732 TCTTCCATGGATATTGAGGAAGG + Intronic
901829977 1:11886420-11886442 TTTTCCCTGGAGAGGGAGGGTGG - Intergenic
902329256 1:15723056-15723078 TTCTCCTTGGACCTGGAGGAAGG + Intronic
903790371 1:25888831-25888853 TGTTCCAGGAAAAAGGAGGATGG + Intronic
904824516 1:33265743-33265765 TTTTCAATGGACAAGCTGTATGG - Intronic
904983576 1:34526475-34526497 TTTCCCAGGTACAAGAAGGATGG + Intergenic
905108668 1:35578660-35578682 TTGGCCCTGGAGAAGGAGGAGGG + Intronic
905502235 1:38448992-38449014 TTCTCCATGGAGAAGGTGGCTGG + Intergenic
906453122 1:45969811-45969833 TTTTCCATGGACCAGGAAGTGGG - Intronic
906664740 1:47612529-47612551 TTTTCCACGGACATGGGGGCAGG - Intergenic
906740763 1:48181587-48181609 TTTTCCATGGACTGGGGGAAGGG + Intergenic
907157409 1:52347108-52347130 TTTTTTATGGAGAAGGAGAAAGG - Intronic
907788297 1:57635713-57635735 TTTTCCATGGACCAGGGTCAGGG - Intronic
908017699 1:59861601-59861623 TTTTCTATGGATAAGGAATATGG + Intronic
908798488 1:67854779-67854801 TTTACCATGGAGAAGGAGAAGGG - Intergenic
908952638 1:69580018-69580040 TTGTTCATGGACCAGGACGATGG - Intronic
908957268 1:69648441-69648463 TTCTCCCTGGACATGGAGCAAGG - Intronic
909925255 1:81430821-81430843 TTTTCCATGGACACAGAGGGAGG - Intronic
910222169 1:84898602-84898624 TTTTCCATGGACAGGGGTGGGGG + Intergenic
911005131 1:93212771-93212793 TTTTCCATGGACCAGGGACAGGG + Intronic
911014759 1:93320423-93320445 TTTTCCATGGACTAGGGTTATGG + Intergenic
913325052 1:117620843-117620865 TTTTCCATGGACCTGGAAGAGGG - Intronic
913513038 1:119580035-119580057 TTTTGCAGGGACATGGATGAAGG + Intergenic
913558647 1:119996210-119996232 TGTTCCATGGAGAGGGAGAAAGG - Intronic
913639196 1:120794261-120794283 TGTTCCATGGAGAGGGAGAAAGG + Intergenic
914279254 1:146155697-146155719 TGTTCCATGGAGAGGGAGAAAGG - Intronic
914540298 1:148606627-148606649 TGTTCCATGGAGAGGGAGAAAGG - Intronic
914626346 1:149464587-149464609 TGTTCCATGGAGAGGGAGAAAGG + Intergenic
915135818 1:153730705-153730727 GTTTCCAGGGAAAAGGGGGAGGG + Intronic
915305932 1:154978389-154978411 TTTTCGATGGAGAATGAGGCAGG - Intronic
916425270 1:164674268-164674290 TTACACATGGACAAAGAGGAAGG + Intronic
917417186 1:174822584-174822606 TTTTCCATGGTGGAGGGGGAGGG + Intronic
917633292 1:176910960-176910982 TTTTCCATGGACAGGTCAGAGGG - Intronic
918750903 1:188268306-188268328 GTTTCCATGGACCAGGGGGATGG + Intergenic
919135650 1:193505352-193505374 TGTTCAATGGGCAAGGAGAAAGG + Intergenic
919508420 1:198429519-198429541 TTTTCCAGGGAAAAGGATGATGG - Intergenic
919774812 1:201187553-201187575 TTGACCGTGGCCAAGGAGGATGG + Intergenic
920013469 1:202887138-202887160 CTTGCCATGGAAAAGGAGTATGG + Intronic
921544573 1:216459297-216459319 TTTTCCAAAGAAAAGGAGGAAGG - Intergenic
921981646 1:221264866-221264888 TTTTCCTTGAAAGAGGAGGAGGG - Intergenic
922380672 1:225020961-225020983 TTTACCATGGAGAAGTAGGAAGG + Intronic
923058893 1:230452205-230452227 TTTTCCAGGTAAAAGGAGTAGGG - Intergenic
924726701 1:246678139-246678161 TTTTCCAAGTACAAGGTTGAGGG + Intergenic
1063235053 10:4105439-4105461 TTTTTCATGGACTCGGGGGATGG + Intergenic
1063791856 10:9458987-9459009 TTCACCATGGAAAAGGAGGTGGG + Intergenic
1063835035 10:10002671-10002693 TTTTCCATGGACTAGGGGGTTGG - Intergenic
1063938331 10:11102229-11102251 TTTGCCATGGACTGGAAGGAAGG - Intronic
1064088981 10:12367379-12367401 TTTTCCATGGACGAGGGGTGGGG + Intronic
1064621433 10:17221675-17221697 TTTTCCATGGACCAGGCAGGGGG - Intergenic
1066345729 10:34584217-34584239 GTCTACATGGACAAAGAGGAAGG - Intronic
1066418752 10:35245249-35245271 TTTTCACTGTACAAGGAGGCAGG + Intergenic
1066543077 10:36470129-36470151 TTTACCATGGAGAAGAATGAGGG + Intergenic
1066698367 10:38099286-38099308 GTTGCCAGGGGCAAGGAGGAAGG - Intronic
1066994149 10:42547865-42547887 GTTGCCAGGGGCAAGGAGGAGGG + Intergenic
1067183064 10:44005143-44005165 TTTTTCAAGGACCAGGAAGAAGG + Intergenic
1068374636 10:56163407-56163429 TTTTCCATGGACCAGGAGTATGG + Intergenic
1068737506 10:60431020-60431042 TTTTCCACGGACCAGGAGAGGGG + Intronic
1071671072 10:87610052-87610074 TTTTCCATGGACCAGGGTGGGGG - Intergenic
1071909129 10:90211074-90211096 TTTTCCATGGACCAGGGGCAAGG + Intergenic
1072133672 10:92522248-92522270 TTTTGCATAGAGAAGTAGGAAGG - Intronic
1073659976 10:105464102-105464124 TTTTCCATGGACTAGGGGTGGGG - Intergenic
1073842279 10:107511436-107511458 TGTTCCATGGCCAAGAAGGTAGG + Intergenic
1074901938 10:117824560-117824582 TTTTCCATGGACCAGGCAGTGGG - Intergenic
1075013175 10:118892062-118892084 TTTTCTATGGACCAGGATGGGGG + Intergenic
1075471789 10:122696547-122696569 TTGGCCATCAACAAGGAGGATGG - Intergenic
1075927816 10:126267292-126267314 TTTTCCATGGACCAGGGGTGGGG + Intronic
1077559067 11:3245850-3245872 TTTTCCATGGACCAGGGAGGGGG - Intergenic
1078380536 11:10836079-10836101 TTTTCCATGGACCAGTATGGGGG - Intronic
1078571794 11:12464885-12464907 TTTTCCATGGACATGGGGTTGGG + Intronic
1078718839 11:13864816-13864838 TTTTCCATGGACATGGGGGATGG - Intergenic
1079112276 11:17611527-17611549 TTTTTCAGGGACCAGGAGCATGG - Intronic
1079357957 11:19745634-19745656 TTTTCCATGGACAGAGATGCAGG + Intronic
1079758693 11:24300677-24300699 TTTTCCAATGTAAAGGAGGAGGG + Intergenic
1079917629 11:26390304-26390326 TTTTCCCTCTAAAAGGAGGAGGG - Intronic
1080308541 11:30863263-30863285 TTTTCCATGGCCAAACAGCAGGG + Intronic
1080739974 11:35054848-35054870 TTTTCCATGGAGCAGGGGCAGGG - Intergenic
1080871068 11:36237447-36237469 TTTTTCATGTAAAAGGAGGCTGG - Intergenic
1080911175 11:36600540-36600562 TTTTCCATGGACCAGAGTGAGGG - Intronic
1081176732 11:39936485-39936507 TTTTCCATGGACAAGGGGGGAGG + Intergenic
1081208986 11:40308650-40308672 TTTTCCATGGACTATAAGAAGGG + Intronic
1081294218 11:41365463-41365485 TTTTCCATGGACTAGGGGTGGGG - Intronic
1081495287 11:43602999-43603021 TTTTCCAGGCACAGGGAGGCTGG + Intronic
1081618478 11:44604531-44604553 TATTATATGGACAAGAAGGAAGG + Intronic
1082608990 11:55276813-55276835 TTTTCCATATTCTAGGAGGATGG + Intergenic
1083344194 11:61978117-61978139 TTTTCCATGGACAAGGGGTGGGG - Intergenic
1084587212 11:70069181-70069203 CTTTCCTTGGTCAGGGAGGATGG - Intergenic
1084932358 11:72567114-72567136 TTTTCCACGGACGAGGAGTGGGG + Intergenic
1085576155 11:77605648-77605670 TTTTCCATGGACTGGGGGCATGG - Intronic
1086181172 11:83953504-83953526 TTTTCCATGGACAGGTGGCAGGG - Intronic
1086538104 11:87874124-87874146 TTCTCTATGAACAAGGAGTAGGG - Intergenic
1086701557 11:89905438-89905460 TTTTCCATATTCTAGGAGGATGG - Intergenic
1086704610 11:89939087-89939109 TTTTCCATATTCTAGGAGGATGG + Intergenic
1087122734 11:94591757-94591779 CTTTCCTGGGACAGGGAGGAGGG - Intronic
1087869475 11:103274249-103274271 CTTTGCATGGTCAAGGTGGAAGG + Intronic
1087980028 11:104600616-104600638 TTTTCCAGGGATTAGGAAGAAGG + Intergenic
1089951731 11:122534549-122534571 TATTCCTTGGTCAGGGAGGACGG - Intergenic
1090659004 11:128867722-128867744 TTTTCCATGGACCAGGGAGGTGG + Intergenic
1090777813 11:129980521-129980543 TTTTCCATGGACAAGGGGTTGGG - Intronic
1091375334 12:21544-21566 ATCTCCATGGACTAGCAGGATGG + Intergenic
1091821664 12:3480050-3480072 TCTTCCATGGACATGGATAATGG + Intronic
1092049675 12:5459256-5459278 TTTATCAGGGTCAAGGAGGAAGG - Intronic
1093006893 12:14060915-14060937 TTTTACATAGATAAGGTGGAGGG - Intergenic
1095335584 12:41021390-41021412 TATTCCATGGACAAGGGATAAGG - Intronic
1095538458 12:43279741-43279763 TTCTCCATGGACCAGGGGGTAGG + Intergenic
1095654356 12:44651173-44651195 TTTTCCATGGACAAGTGGGGTGG - Intronic
1095764343 12:45877598-45877620 TTTTCCATGGACCAGGGGTTGGG - Intronic
1097125878 12:56774494-56774516 TTTTCCATGGACAGGGAGTGGGG + Intronic
1098172750 12:67763108-67763130 TTTTCCATAGACAGGGTGGGGGG - Intergenic
1099195264 12:79608287-79608309 TTTTCCAAGGACCAGGGGGATGG + Intronic
1099542285 12:83927500-83927522 TTGTCCATGGACAAACAGCAAGG + Intergenic
1100040264 12:90308771-90308793 TTTTCCACTGACAAGAATGATGG - Intergenic
1100046487 12:90387519-90387541 TATCACATGGCCAAGGAGGAAGG - Intergenic
1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG + Intronic
1101184175 12:102255897-102255919 CTTTGCATGGACATGGATGAAGG + Intergenic
1101760525 12:107655012-107655034 GTGACCATGGTCAAGGAGGAGGG - Intronic
1101819075 12:108169333-108169355 TTTTCCATGGACCAGGGGGTGGG - Intronic
1103238345 12:119393315-119393337 TTTTCCTTGGAAAGGGAGGAGGG + Intronic
1103429082 12:120866207-120866229 TTTTCTATGGATGGGGAGGAGGG - Intronic
1104088101 12:125493907-125493929 ATTTCCAGGGAGGAGGAGGAGGG - Intronic
1104092661 12:125528865-125528887 TTTTCCATGGACCAGGATGAGGG + Intronic
1104190848 12:126480571-126480593 ATTTCCAAGGAAAAAGAGGAGGG - Intergenic
1104248414 12:127065093-127065115 CTTGCCATGGAGATGGAGGAAGG - Intergenic
1104576564 12:129972017-129972039 TTTTCCAGGAACAAGGGGGCTGG + Intergenic
1105832128 13:24172078-24172100 GTGTGCATGGACAAGCAGGAGGG - Intronic
1106053307 13:26212162-26212184 TTTTTCATGGCCCAGGAGGATGG - Intronic
1106679229 13:31993055-31993077 GTTGCCATGGACTAGGAGGCAGG - Intergenic
1107221509 13:37986731-37986753 TTTTCCATGGACCCAGGGGATGG - Intergenic
1107369555 13:39729300-39729322 TTTTCCGTGGACAAGAAGTTGGG - Intronic
1107570646 13:41654438-41654460 TTTTCCAGGGACAGGGTAGAGGG + Intronic
1107603149 13:42033551-42033573 TTTTCCACGGACAATGGGGTGGG - Intergenic
1107729311 13:43332213-43332235 TTTTCCATGGACAGGGGGTTGGG + Intronic
1107898202 13:44987132-44987154 TTTTCGGAGGCCAAGGAGGATGG + Intronic
1108344474 13:49531348-49531370 TTTTCCACGGACCATGGGGATGG + Intergenic
1109070779 13:57764192-57764214 TTTTCCATGGACCAGGGAGTTGG - Intergenic
1109317423 13:60766771-60766793 TTTTCCATGGATGAAGAAGAGGG + Intergenic
1109410672 13:61963785-61963807 TTTTCCATGGATCAGGGGGTTGG + Intergenic
1109837115 13:67874631-67874653 TTTTCCATGGACTGGGATGTGGG - Intergenic
1109904171 13:68816603-68816625 TTTTCCATGCACTAGGGGCAAGG + Intergenic
1110077679 13:71269462-71269484 TTTTCCATGGATGGGGAGGTGGG + Intergenic
1110283834 13:73726444-73726466 CTTGCCAAGGACTAGGAGGAAGG - Intronic
1110410552 13:75199945-75199967 TCTTCCATTAACAAGAAGGAAGG + Intergenic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1114076398 14:19163558-19163580 TTTACCATGGGGGAGGAGGAGGG + Intergenic
1114085771 14:19236011-19236033 TTTACCATGGGGGAGGAGGAGGG - Intergenic
1114832996 14:26167737-26167759 TTTTCCTTGGACCAGCAGGTAGG + Intergenic
1115662455 14:35510798-35510820 TTTTCCATGGACAGGGGTGGGGG + Intergenic
1115819451 14:37198188-37198210 TTTTCCTTGGAGAAGGAGAAGGG + Intronic
1116032722 14:39592051-39592073 TTTTCCAAGGACAAGGATTTAGG + Intergenic
1116419169 14:44713231-44713253 TTTTCCATGGACTAGGGGTTGGG + Intergenic
1116443814 14:44985439-44985461 TTTTCCATAGACTAGGGGGTGGG + Intronic
1116588466 14:46740279-46740301 TTTTCCATGGACATGGGCGGGGG - Intergenic
1117558061 14:56906960-56906982 TTTTCCATGGACTAGATGGGGGG + Intergenic
1117697015 14:58375952-58375974 TGTTCCAGGGACATGGGGGAGGG + Intergenic
1118583388 14:67327408-67327430 TTTTCAGAGGCCAAGGAGGACGG + Intronic
1118858785 14:69645557-69645579 CTTTCCATGGAAGAGGTGGAGGG + Intronic
1120051823 14:79876129-79876151 TTCCCCATGGACACTGAGGAAGG - Intergenic
1120663707 14:87280544-87280566 TTTTCCATGGACAGGGGTGGGGG - Intergenic
1120685698 14:87534072-87534094 TTTTCCATGGACCTGGGGGTGGG - Intergenic
1121078171 14:91086323-91086345 TTTTCCATGGACCAGGCAGGGGG - Intronic
1121170641 14:91851150-91851172 TTTTCCATGGACTAGGGGTGAGG - Intronic
1121250073 14:92492867-92492889 TGATCGAGGGACAAGGAGGAAGG + Intronic
1121278723 14:92685375-92685397 TTCTCCCTGGGCAAGCAGGAAGG + Intronic
1121445657 14:93977255-93977277 TCTTCCCTAGACCAGGAGGAAGG - Intergenic
1121817358 14:96938841-96938863 TCTTCCATGGACCAGCAGGATGG - Intergenic
1121958587 14:98237818-98237840 TTTTCCACGGACTGGGAGCAGGG + Intergenic
1202897323 14_GL000194v1_random:17724-17746 TTTACCATGGGGGAGGAGGAGGG - Intergenic
1123927622 15:25133850-25133872 TTTTACATGGACAAGGAGGAGGG - Intergenic
1124140389 15:27072313-27072335 GTGTCCATGGAGAAGGAGGTAGG - Intronic
1124601629 15:31137362-31137384 TTTTTCATGGACAAGAATTATGG + Intronic
1125995762 15:44159360-44159382 TATTCCATGGTAAAGGAGTACGG + Intronic
1126644718 15:50863504-50863526 TTTCCCATGCACAAGCAAGAAGG + Intergenic
1126823516 15:52528438-52528460 TTTTCCAAAGCCAAGCAGGAGGG + Intronic
1127149062 15:56055045-56055067 TTTTCCATGAACAGGGATGGGGG + Intergenic
1127214303 15:56808477-56808499 TTTTCCATGGAAAATGAAGATGG - Intronic
1127385484 15:58463201-58463223 TCTTCCATGGACATGGAGGTGGG + Intronic
1127630895 15:60826661-60826683 TTTCCCATGGAGGAGGAGGAGGG + Intronic
1127778464 15:62289283-62289305 TTTTGCAAGGACCAGGTGGATGG + Intergenic
1127996497 15:64156021-64156043 TTTGCCATCGCCAAGGAGTAGGG - Exonic
1128248739 15:66150528-66150550 TTGCCCATGGACAGGGAGGGTGG - Intronic
1128420635 15:67488645-67488667 TTTTCCATGGACGTGGAGGTGGG + Intronic
1129793660 15:78360087-78360109 TTTTTCATAGAAAAGGAGGGAGG + Intergenic
1130429467 15:83832021-83832043 TTGCTCGTGGACAAGGAGGAGGG + Intronic
1130714155 15:86315101-86315123 CTTGCAATGAACAAGGAGGATGG - Intronic
1130971346 15:88736161-88736183 TTATCTTTGGAAAAGGAGGAAGG + Intergenic
1131810615 15:96169272-96169294 TTTTCCATGGACAGGGTTGTGGG - Intergenic
1133119957 16:3600076-3600098 TTTTCCATGGGACAGGAGTAGGG + Intronic
1134379080 16:13707750-13707772 TTTTCCATGGACCAGGAAGCGGG - Intergenic
1134689135 16:16179487-16179509 TTTTCCATGGACCTGGGGGCAGG + Intronic
1135679237 16:24442588-24442610 TTTTCCATGGACAGCAGGGAGGG + Intergenic
1135842875 16:25892749-25892771 TATTCCCTGGAAAAGGAGGGCGG - Intronic
1135853326 16:25984253-25984275 TTTTCCATGGCCAGGGATGGGGG + Intronic
1136127151 16:28192420-28192442 TTTGCCATTGACAAAGAGGATGG - Intronic
1136232351 16:28894158-28894180 TTTATCATTGACAAGGTGGATGG + Exonic
1136372535 16:29845327-29845349 TGTTCCAGGGACGAGGAGCATGG - Intronic
1136427453 16:30178588-30178610 TTCTCCATGGAGAAGGCGGAGGG + Intergenic
1138000019 16:53268529-53268551 ATTTATATGCACAAGGAGGAGGG - Intronic
1138019616 16:53466331-53466353 TTTTCCATGGACAGGGTTGGGGG + Intronic
1138199794 16:55080216-55080238 TTTGCCAGGGAAGAGGAGGAAGG + Intergenic
1138203652 16:55108314-55108336 TTTTCCATGGGCCAGGATGGAGG + Intergenic
1138425788 16:56931513-56931535 TTTTCCTTGGGCTGGGAGGATGG - Intergenic
1139180110 16:64737069-64737091 TTTGCCATGGACAAGGTGCCAGG - Intergenic
1139263894 16:65622012-65622034 TGTTACAGGGACACGGAGGAGGG + Intergenic
1139375047 16:66491630-66491652 TTTTCCACAGACAGGGTGGAGGG + Intronic
1139528305 16:67529492-67529514 TTTTCCCTGGAAATGGAGGTTGG + Intronic
1139610793 16:68056347-68056369 TTTTCTCTGGAAAAGGATGAAGG - Exonic
1140298609 16:73733977-73733999 TTTTCCATGGATTGGGAGGTGGG + Intergenic
1140346813 16:74221209-74221231 TTTGCCATGGACAAGGTGCCAGG - Intergenic
1140920296 16:79531377-79531399 TTTTCCATGGACTGGGAGTGGGG + Intergenic
1141290768 16:82716302-82716324 TTTTCCATGGGAAAGGTGGTGGG + Intronic
1141753936 16:85978832-85978854 TTTTCCAAGGGCAAGGAGAAAGG - Intergenic
1142116798 16:88360902-88360924 TTTTTCATGGACAAGGGGTGAGG + Intergenic
1142542133 17:667996-668018 TTTTCCATGGACCAGGGAGGGGG - Intronic
1142809863 17:2390583-2390605 TTTTCCATGGAGAGGGAGGGCGG - Intronic
1143137086 17:4718006-4718028 GCTTCCCTGGACAAGGAGGTGGG + Exonic
1143209613 17:5175432-5175454 TTTTCCACGGACTGGGGGGATGG - Intergenic
1143659887 17:8318368-8318390 TATTCTGGGGACAAGGAGGAAGG - Exonic
1143812318 17:9481912-9481934 TTTTCCATGGACCAGGATGGGGG - Intronic
1143863587 17:9908383-9908405 CTCTCCAGGCACAAGGAGGAAGG + Intergenic
1144557895 17:16298061-16298083 TTTTCCATGGACAGGGGTGGGGG - Intronic
1144617792 17:16792289-16792311 TTTTCCACGGACTGGGGGGATGG + Intronic
1144619094 17:16804892-16804914 TTTTCCACGGACTGGGGGGATGG - Intergenic
1145239291 17:21230642-21230664 GTTTCCAGGGGCAGGGAGGAGGG - Intergenic
1145779777 17:27554747-27554769 TTTTCCAGGGACAGGGAGCGGGG - Intronic
1145834674 17:27945268-27945290 TTTTTCATGGACAAGGGGCAGGG + Intergenic
1146484112 17:33229560-33229582 TTTTCCATGCAAAAGGGAGAGGG + Intronic
1146613806 17:34334719-34334741 TTTTGCAGGGACATGGATGAAGG - Intergenic
1147166864 17:38598168-38598190 CTTTCCATGGATAAGGGGGCTGG + Intronic
1147303208 17:39546095-39546117 TGTTCCATAAAAAAGGAGGAAGG - Intronic
1147475760 17:40710189-40710211 TTTTCCATAGACCAGGTGGGTGG - Intergenic
1147490941 17:40865488-40865510 TTGAGCATGGAAAAGGAGGAAGG + Intronic
1147506106 17:41019142-41019164 TTTTCCATGGACCAGGGAGGTGG + Intronic
1148391906 17:47278889-47278911 TTTTCCATGGACAGGGAGGTGGG - Intronic
1148399196 17:47339339-47339361 TTTTCCATGGACGAGGGGATGGG + Intronic
1149025686 17:52025076-52025098 TTTTCCATGGACCAGGGGTTGGG - Intronic
1149284487 17:55147214-55147236 TTTTTCATGGACCAGGGGGTAGG + Intronic
1149710970 17:58741861-58741883 TTTTCCACGGACGAGGGGCAGGG - Intergenic
1150118919 17:62582794-62582816 GGTTCCAAGGACAAGGAGGAGGG - Intronic
1150527858 17:65942304-65942326 TTTTCCATGGACCTGAAGGATGG - Intronic
1150680424 17:67280055-67280077 CTTTCCAGGGAAAAGGGGGAGGG - Intergenic
1150902778 17:69299987-69300009 TTTTCCACAGACAGGGAGCAAGG + Intronic
1152029443 17:77832725-77832747 TTCTCCATGGACTAGGGGCAGGG - Intergenic
1152047663 17:77948623-77948645 TATGCCATGGACAGGCAGGATGG - Intergenic
1153159485 18:2187656-2187678 TGTTCCATGGGAAAGGAGGGAGG - Intergenic
1153429738 18:5002942-5002964 TTTTCCATGGACAAGATGCCAGG + Intergenic
1155263434 18:24067672-24067694 TTTTCCATGGACTGGGTTGAGGG - Intronic
1155285309 18:24282085-24282107 TTTTCCATGGACTCGGGGGTAGG - Intronic
1155528170 18:26738714-26738736 TTTTCCACGGACAGGGTGGTGGG - Intergenic
1155702215 18:28760691-28760713 TTTTCCACGGACAGGTTGGATGG - Intergenic
1156034065 18:32747242-32747264 TTTTCCATGGACCAGAGGGATGG + Intronic
1156492738 18:37505942-37505964 TTTTCCATGGGACAGGAGGGTGG + Intronic
1156536503 18:37869645-37869667 TTTTCCATGGACTGGGGGCAGGG + Intergenic
1156727536 18:40147741-40147763 TTTTCCATGGACTGGGATGGGGG + Intergenic
1156808623 18:41220288-41220310 TTTTCCAGTGACAAGAAGCAGGG + Intergenic
1156996744 18:43478380-43478402 TTGACAATGGATAAGGAGGAAGG - Intergenic
1157000173 18:43513852-43513874 TCCTCCATGGACATGGATGAAGG + Intergenic
1157423186 18:47563052-47563074 TTTTCCATGGACAGAGGGTAGGG - Intergenic
1157472554 18:48001255-48001277 TTTTCCATGGACCAGAGGGTGGG - Intergenic
1157552484 18:48591131-48591153 GTCTCCATGGACAAGGGAGATGG - Intronic
1157715566 18:49884288-49884310 TTTTCCACGGACCAGGGTGACGG + Intronic
1157824274 18:50798420-50798442 TATTCCATGGAAAGGCAGGATGG + Intronic
1158216060 18:55102072-55102094 TTTTCCATGGACTGGGAAGTGGG + Intergenic
1158665970 18:59433109-59433131 TTTTGCAGAGAGAAGGAGGAAGG + Exonic
1158691759 18:59667364-59667386 TTCTCCAGGGCCAAGGAGGAAGG + Intronic
1158743283 18:60167914-60167936 TTCTCCAGGGCCAAGGGGGAAGG + Intergenic
1158753931 18:60299802-60299824 TTTTCCATGGACCAGGACAGAGG + Intergenic
1159258413 18:65978318-65978340 TTTGTCATGGAGAAGGTGGAGGG - Intergenic
1159738061 18:72128471-72128493 GTTTCCAGGGACTAAGAGGAGGG - Intergenic
1162004818 19:7770879-7770901 TTTTCCACGGACCAGGGGAAGGG + Intergenic
1162397159 19:10423907-10423929 ATTCCCAGGGAAAAGGAGGAAGG + Intronic
1163391099 19:17030333-17030355 TTTTCCATGGACAAGGGGCAAGG + Intergenic
1164526533 19:29017321-29017343 CCCTCCATGGAGAAGGAGGATGG - Intergenic
1164871272 19:31646108-31646130 GTTTCCATGGGCAAGCAGGTGGG - Intergenic
1164911118 19:32012724-32012746 CTTTTCAAGGACAAGGAAGATGG - Intergenic
1164926547 19:32135100-32135122 TTTTCCATGGACACTGAAGGTGG + Intergenic
1165072202 19:33261927-33261949 GAGTCCATGGACAAGGAGCATGG + Intergenic
1166171528 19:41030719-41030741 TTTTCCTTTGAGAAGGGGGAAGG + Intergenic
1166812949 19:45525105-45525127 TTTTCCATCAACAAGAAAGAGGG + Intronic
1166908650 19:46134341-46134363 TTTTCCATGGACAAAGGAGGAGG + Intergenic
1168384692 19:55953413-55953435 TTTTCCATGGACCAGGTGGCGGG - Intronic
1168561215 19:57384885-57384907 TTTTCCATGGATAAGGGAGAGGG - Intronic
925591020 2:5509258-5509280 TTTTCCAAGGACAAGAAGTGAGG - Intergenic
925862079 2:8188693-8188715 TTTTCTACAGACCAGGAGGAGGG + Intergenic
926562237 2:14430393-14430415 TTTTCCATGGACATGGCAGGTGG - Intergenic
926901344 2:17754314-17754336 TCTTCCAGAGCCAAGGAGGAAGG + Intronic
927635949 2:24816987-24817009 TTTACCATTTACAAAGAGGAAGG - Intronic
927640428 2:24842137-24842159 TTTTCCAGGGACTAGAAGCAAGG - Intronic
928243263 2:29605139-29605161 TTTTCCACGGACAGGGGGGTGGG + Intronic
928539462 2:32270670-32270692 TTTTCCATGGATAGGGAGTGAGG - Intergenic
928583271 2:32730260-32730282 TTTTCAATGGTCTAGGAGTATGG - Intronic
929762660 2:44818917-44818939 TTTTCCATGGACCAGGGGGTGGG + Intergenic
930317713 2:49817578-49817600 TTTTCCATGGACAAGGGGGAGGG - Intergenic
930917300 2:56708981-56709003 GTATCCATGGAAAGGGAGGAAGG + Intergenic
931650617 2:64465550-64465572 TTTTCCACAGACAGCGAGGAGGG + Intergenic
931771018 2:65498160-65498182 GTTACCATGGCCAAGGGGGAGGG - Intergenic
932228143 2:70059522-70059544 TTTTCCATGGACAAAGGGGAGGG + Intergenic
933423096 2:82077118-82077140 TTTTCCATGGACTACGTGGTGGG + Intergenic
933787349 2:85854085-85854107 TTTTTCATAGAGAAAGAGGAAGG - Intronic
935682575 2:105650874-105650896 TTTTCCATGGACAAGGGGGTGGG + Intergenic
935725709 2:106022069-106022091 TTTTCCACGGACAGGGATTAGGG - Intergenic
935811016 2:106797163-106797185 TTTTCCTTGGAGAAGGGAGACGG + Intergenic
935836212 2:107057118-107057140 GTTTCTATGCACAAGGAGGGAGG + Intergenic
936107945 2:109641573-109641595 GTTTCCAGGGGCTAGGAGGAAGG + Intergenic
936689948 2:114874691-114874713 TTTTCCATGGACCAGGGGTTGGG - Intronic
938490990 2:131761073-131761095 TTTACCATGGGAGAGGAGGAGGG + Intronic
940329687 2:152460991-152461013 TTTTCCATGGACCAGGTAGTGGG - Intronic
940610048 2:155978848-155978870 TTTTCCATGGACCAGGGAGGGGG - Intergenic
940706812 2:157115827-157115849 TTTTCCAGGGACTTGGAGGTTGG + Intergenic
940725024 2:157327280-157327302 TCTTCCAAGGACAAGGGAGAGGG - Intronic
941730322 2:168910413-168910435 TTCTCCATGGAAACGGAGAACGG - Intronic
941949560 2:171139796-171139818 TTTTCCATGGACCAGGGGTGGGG + Intronic
942523136 2:176825656-176825678 TCTTGCATGGGGAAGGAGGAAGG - Intergenic
943248166 2:185483199-185483221 TTTTCCATGGACTGGGTGGAGGG - Intergenic
943341122 2:186683459-186683481 TTTTACATTTAAAAGGAGGATGG + Intergenic
943743015 2:191431500-191431522 TTTTCCATGGACAGTTGGGAGGG - Intergenic
943853192 2:192754890-192754912 TTTTCCATGGACAGGGCAGGCGG - Intergenic
944300911 2:198123896-198123918 TTTTCCATGGACTGGGGGGCTGG - Intronic
944775831 2:202963518-202963540 TTTTCCACGGACCAGGATGGGGG + Intronic
945212394 2:207397427-207397449 TTTTCCATGGAAATGGAGACTGG - Intergenic
945868225 2:215200482-215200504 TTTCCCTTGGCCAGGGAGGATGG - Intergenic
946078334 2:217094710-217094732 TTTTCCATGGACCAGGATGGGGG + Intergenic
946150385 2:217762178-217762200 TTTTCCATGGACAAGGGTGGGGG + Intergenic
946170498 2:217892621-217892643 TTTTCCCTGGGCCAGCAGGAAGG - Intronic
947230270 2:227877602-227877624 TTTTCCACAGACCAGGGGGATGG + Intronic
948165387 2:235857336-235857358 TTTTCCACGGATAGGGAGGAGGG - Intronic
948334296 2:237195297-237195319 TTTTCCATGGAGATGGAGTCCGG - Intergenic
1169405915 20:5321135-5321157 TTCTCCATAGACAGGGAGCATGG - Intergenic
1169417025 20:5425984-5426006 TTTTCCATGGACTGGGATGGGGG + Intergenic
1169519386 20:6354790-6354812 TTTTCCATGGAACATGAGGATGG + Intergenic
1169702392 20:8461722-8461744 GTTTCGACGGTCAAGGAGGAGGG + Intronic
1170895780 20:20413078-20413100 TTTTGCATTGATAATGAGGAAGG - Intronic
1171090508 20:22281675-22281697 TCTGCCTTGCACAAGGAGGAAGG - Intergenic
1171405950 20:24912680-24912702 TTTTTCATGGAGAAGAATGAGGG + Intergenic
1172527780 20:35610829-35610851 TTTTCCATGGACAGGGTCGGGGG + Intergenic
1172548619 20:35781419-35781441 TTTTGCATGGTCAAGAATGAAGG - Intronic
1173891690 20:46517283-46517305 TTTTCCATGGACAGGGTTGGGGG + Intergenic
1174030772 20:47624166-47624188 TTTTCCATGGACCTGGTAGAGGG + Intronic
1174080349 20:47967073-47967095 TTTGCTCTGGACAAGGTGGATGG - Intergenic
1175550782 20:59815951-59815973 TTTTCCATGGACCAGGGAGGAGG + Intronic
1175665915 20:60859890-60859912 TTTTCCATGGACCAGGGAGGGGG + Intergenic
1175765063 20:61586752-61586774 TTTTCCAAGGGCAAACAGGATGG - Intronic
1175785172 20:61707679-61707701 TTTTCCATGGACCATGAGTAGGG + Intronic
1176617008 21:9033713-9033735 TTTACCATGGGGGAGGAGGAGGG - Intergenic
1177043054 21:16136319-16136341 TTTTCCATGGACTGGGACTAAGG - Intergenic
1177535780 21:22425137-22425159 TTTTCCATGGATAGGGAGTGTGG + Intergenic
1178296187 21:31412410-31412432 TTTTCCATGGATGAGGGGGTGGG + Intronic
1178380643 21:32104858-32104880 TTTTCCATGGACCAGGGGTTGGG - Intergenic
1178533831 21:33396564-33396586 TTTTCCAAGGACCAGGCGGGGGG - Intergenic
1178584020 21:33858096-33858118 TTTTCCAGAGCCCAGGAGGAGGG + Intronic
1179634091 21:42696385-42696407 TTTTCTAGGGACAAGGGGCAGGG + Intronic
1180292203 22:10857182-10857204 TTTACCATGGGGGAGGAGGAGGG + Intergenic
1180495008 22:15886604-15886626 TTTACCATGGGGGAGGAGGAGGG + Intergenic
1181026085 22:20128562-20128584 TTTTCCATGGACCAGGGGTGGGG - Intergenic
1181554381 22:23659569-23659591 TATTTCATAGCCAAGGAGGAAGG - Intergenic
1181972340 22:26700531-26700553 TTTTCCATGGACAGTGAGGGTGG - Intergenic
1183052014 22:35270507-35270529 TTTTCCATGGACCTGGGGCAGGG - Intronic
1184024542 22:41845250-41845272 TTTTCCATGGACATAGATGAAGG + Intronic
1184272391 22:43392317-43392339 TGATTCATAGACAAGGAGGAAGG + Intergenic
1184435439 22:44471711-44471733 TTTGCTAGGGGCAAGGAGGAGGG - Intergenic
1184507009 22:44909988-44910010 TTTTCCAAGGGCAAGGACCATGG + Intronic
1184951939 22:47849437-47849459 TTTTCCTTGGACTAGGGTGAGGG - Intergenic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
949841187 3:8321814-8321836 TGGTCTATGGACCAGGAGGATGG + Intergenic
950636991 3:14322525-14322547 TCTTCCATGGCCAGGGAGGGTGG + Intergenic
951423785 3:22518735-22518757 TTTTCCATGGACCAGGTGGAGGG + Intergenic
951512230 3:23515518-23515540 GTATCCATGTCCAAGGAGGAGGG - Intronic
952629691 3:35452293-35452315 TTTTAAATGGCCAAGGACGAGGG + Intergenic
953027543 3:39153618-39153640 TTTTCCACTGACGAGGAGGGCGG - Intronic
953191729 3:40694190-40694212 TAGTCCATGCACAAAGAGGAGGG - Intergenic
953309881 3:41866384-41866406 TTTTCCATGGACCAGGGTTAGGG + Intronic
954433309 3:50482822-50482844 TTTTGCATGGACAAGCAAGAAGG - Intronic
954646477 3:52134833-52134855 TGTCCTATGGATAAGGAGGATGG - Intronic
954766174 3:52918894-52918916 TTTTCCATGGACCAGGGGGTGGG + Intronic
955617620 3:60825739-60825761 TTTTCCATGGATGGGGAGGTGGG - Intronic
955819325 3:62879438-62879460 ATTTACATGGACAAGATGGAGGG + Intergenic
955851439 3:63224358-63224380 TTTTCCATGGACAGGGATGAGGG - Intergenic
956591908 3:70924199-70924221 TTTTCCATGGCCATGGGGTACGG + Intergenic
958898961 3:99863102-99863124 TTTTCCATGGACATGGGAGAGGG + Intronic
959341566 3:105138156-105138178 TATTCCATGGACCTGGAGGATGG - Intergenic
959394461 3:105819912-105819934 TTTTCCATGGACCAGGGGCATGG + Intronic
959923125 3:111891644-111891666 TTTTCCATGGACATGGGGGAGGG - Intronic
960020652 3:112948417-112948439 TCCACCACGGACAAGGAGGAAGG + Intronic
960225140 3:115159282-115159304 TTTTTCATGGACAGGGAGAGGGG - Intergenic
960589107 3:119348331-119348353 TTTTCCATGGACCAGGGTCAGGG - Intronic
960659657 3:120043850-120043872 GTTTAGATGGAGAAGGAGGAGGG - Intronic
960864184 3:122183938-122183960 CTTTCCATCGCCAAGGAGTAGGG + Intronic
960965020 3:123098615-123098637 TCTTCCATGGAGAATGTGGAAGG - Intronic
961031763 3:123611577-123611599 TTTTCCATGGACCAGGAGAGGGG + Intronic
961038034 3:123656603-123656625 TTTTCCATGGAGACCAAGGAAGG - Intronic
961195000 3:124994075-124994097 TTTTCCATGGACCAGCAAGGGGG + Intronic
961391609 3:126555663-126555685 TTTTCCATGGACACTGTGGCAGG - Intronic
961822637 3:129582955-129582977 CTGTCCCTGGACAGGGAGGATGG - Intronic
962053240 3:131841630-131841652 TTTTCCATGGACATGGGGTGGGG - Intronic
962110772 3:132444223-132444245 TTTTCCATGGACAGGGCAGGGGG - Intronic
963154585 3:142082410-142082432 TTTTCCATGGACTGGGGTGAGGG - Intronic
963736669 3:149025207-149025229 TTTTCCATGGACCAGTATGGGGG + Intronic
964271447 3:154960574-154960596 TATTGCATAGAGAAGGAGGAAGG + Intergenic
964454125 3:156842099-156842121 TTTCCCATGGACTGGGGGGATGG - Intronic
965194048 3:165571927-165571949 TTTTCCAGGGACTTGGGGGAAGG + Intergenic
965853674 3:173062768-173062790 TTTTCCACGGACAGGTTGGAGGG + Intronic
966824331 3:183951440-183951462 TTTTCCAAAGACATGGATGAAGG - Exonic
966955004 3:184867485-184867507 AATTCCATGGACAAGAAGCAAGG - Intronic
967370506 3:188739589-188739611 AATTCCAGGGAAAAGGAGGAGGG + Intronic
967389315 3:188940053-188940075 TGATGCAAGGACAAGGAGGAGGG + Intergenic
967495136 3:190134751-190134773 TTTTCAGTGGACAAGGCTGAGGG - Intergenic
967589388 3:191255052-191255074 TTTTCCAAGGACCAGGGGGCAGG + Intronic
967899495 3:194434994-194435016 TTCTCAATGGGGAAGGAGGAGGG + Intronic
967951913 3:194847777-194847799 AGTTCCATGGAGAAGGGGGAAGG + Intergenic
968273996 3:197426057-197426079 TTTTCCATGGATAAGGATAAGGG + Intergenic
968939909 4:3632372-3632394 TTTCCAGTGGAGAAGGAGGAGGG + Intergenic
969378466 4:6778739-6778761 TTTTCCATGGACTGGGTGGAGGG + Intergenic
970075140 4:12209833-12209855 TTTTCATTTGACAAGGAAGAGGG - Intergenic
970219676 4:13797836-13797858 TCTTCTATGGACATGGGGGATGG + Intergenic
970867645 4:20777545-20777567 TCTTCCATGAACCAGGAAGAGGG + Intronic
972115497 4:35628342-35628364 TTTTGGATGGGAAAGGAGGAAGG - Intergenic
973903205 4:55499361-55499383 TTTTCCATGGACAGCGGGGATGG + Intronic
973990661 4:56403585-56403607 TTTTCCATGGACCAGGGACAGGG + Intronic
974516691 4:62923708-62923730 ATATCCATGGACAAAGAGGAAGG - Intergenic
975039766 4:69731385-69731407 TTTTCCATGAACAGGGTGCAAGG - Intronic
975748320 4:77496204-77496226 TTTTCCATGGATAGGGATGGGGG - Intergenic
976579884 4:86723465-86723487 TTTTCCACAGACAGGTAGGAGGG - Intronic
977840113 4:101692670-101692692 TTTTCCATTGTCCTGGAGGATGG + Intronic
978317668 4:107457694-107457716 TTTTCCATGGACCAGGGGGTGGG - Intergenic
978360036 4:107921715-107921737 TTTTCCACGGACCAGCAGGGAGG + Intergenic
978952054 4:114572704-114572726 TTTTCCATGGACAGGGGCTAGGG - Intergenic
979027153 4:115592159-115592181 CTTTGCATCCACAAGGAGGAGGG + Intergenic
979115037 4:116812762-116812784 TGTTCCATAGACAATGAAGAAGG + Intergenic
979230768 4:118346858-118346880 TTTTCCGTGGACCTGGGGGATGG - Intronic
979445843 4:120810129-120810151 TTTTCCAAGGACCAGGGGGTGGG - Intronic
979608667 4:122667397-122667419 TTATCTGTGGACAAGGAGAAAGG - Intergenic
981091488 4:140736987-140737009 TTTTCCATGGCCAAGGGTGTGGG + Intronic
981609452 4:146577832-146577854 TTTTCCATGGGCAGGGAGATGGG + Intergenic
982025672 4:151251919-151251941 TTATCCATTGAGAAAGAGGATGG - Intronic
982049446 4:151485968-151485990 TTTTCCATGGATGACGGGGATGG + Intronic
982377274 4:154706888-154706910 TTTTTCATGAACAAGGAGACTGG - Intronic
982678590 4:158403631-158403653 TTTTCCATGGACCAGGGTGGGGG - Intronic
982767909 4:159369039-159369061 TTTTCCATGGACCAGGCAGGGGG - Intergenic
983274711 4:165603209-165603231 TTTTCCATGCACAGGGGGGTGGG + Intergenic
983976688 4:173943452-173943474 TTTTCAAAGGACAATGAGGTGGG - Intergenic
984124861 4:175795504-175795526 TTTTCGGTGGCCAAGGAGGGAGG + Intronic
984379522 4:178972861-178972883 TTTTCTATCCATAAGGAGGAAGG - Intergenic
984682469 4:182625490-182625512 TTTTCCCTGGACCAGGAATAGGG - Intronic
985080517 4:186259900-186259922 TTTTCCATGGACCAGCATGGTGG + Intergenic
985815849 5:2127261-2127283 TTTTCCAGGGACTCAGAGGAGGG - Intergenic
986060739 5:4187918-4187940 ATTTCCATGGCCAGGGAGGGAGG + Intergenic
986197996 5:5555477-5555499 TTTTCCATGGACAGAGAAGGGGG - Intergenic
986788581 5:11138874-11138896 TTCTGCATGGACATGCAGGAAGG - Intronic
986935737 5:12883760-12883782 TTTTCCACAGAAGAGGAGGAGGG - Intergenic
986952108 5:13101328-13101350 TTTTCCATGGACCAGGGTCAGGG - Intergenic
987814465 5:22882434-22882456 TTTTCCGTGGACTAGGGGCACGG + Intergenic
989736041 5:44708050-44708072 GTTTCCATAGACAGGGAGGCAGG - Intergenic
990052223 5:51517834-51517856 TTTTCAATGGACAAAGTGGTTGG + Intergenic
990087142 5:51992814-51992836 GTTTCCAGAGACTAGGAGGAAGG + Intergenic
990442598 5:55861539-55861561 TTTTCCATGGACCTGGGGTACGG - Intronic
990443122 5:55866350-55866372 TTTTCCATGGACAGGGGGTGGGG + Intronic
990937324 5:61164271-61164293 TTTTCCATGGACGGGGATGGGGG - Intergenic
990961509 5:61398391-61398413 TTTTCCATGAACTAGGGGTAGGG - Intronic
991444621 5:66685862-66685884 TTTTCCATAGACTGGGAGGAGGG + Intronic
991655403 5:68899119-68899141 TTTTCAGTGGATAAGGAGGGTGG - Intergenic
991673900 5:69074337-69074359 TTTTCCAAGGAAAAGGACAAGGG + Intergenic
991918475 5:71629309-71629331 GTTGCCAGGGACTAGGAGGAGGG + Intronic
992940250 5:81753398-81753420 TTTTCCAGGGGCAGGCAGGAGGG - Intergenic
993926404 5:93871903-93871925 TTTCCTATGGGAAAGGAGGAAGG + Intronic
993968515 5:94388061-94388083 TTTTCCATGGACATGGACCGTGG + Intronic
995179766 5:109219916-109219938 TTTTCCATGGACAGGGTGTAAGG - Intergenic
995427248 5:112039211-112039233 CTTTGCATGGACATGGATGAAGG + Intergenic
995640237 5:114248162-114248184 TTTTACATGGACAGGAAAGAGGG + Intergenic
995652898 5:114391201-114391223 TTAGCCATGGAAGAGGAGGAAGG - Intronic
996238724 5:121168601-121168623 TTTTCCGTGGACAGGGTAGAAGG + Intergenic
997682032 5:135763527-135763549 TATTCTATGGAGGAGGAGGAGGG + Intergenic
997839895 5:137229703-137229725 TTTTCCACAGACCAGGAGGTGGG + Intronic
997840253 5:137233132-137233154 TTTTCCATGGACCAGGGGAGGGG + Intronic
998487547 5:142516295-142516317 CTTTCCATGGCAGAGGAGGAAGG - Intergenic
998812169 5:145977284-145977306 TTTTCCACAGACCATGAGGAAGG + Intronic
999575438 5:152971713-152971735 TTTTCCATGGGCAAGAAAAAAGG - Intergenic
999598543 5:153234107-153234129 TGTTCCCTGGAGAAGGAGGTGGG - Intergenic
999984686 5:156991911-156991933 CTTTCCATGGACATGGGGGGAGG + Intergenic
1000490470 5:161906551-161906573 CTTTCCTTGAACAAGGATGAGGG + Intergenic
1000706939 5:164524104-164524126 TTTTCCATGGACCAGGTTGTGGG - Intergenic
1000776551 5:165426829-165426851 TTTTCCATGGACAACCAGTAGGG + Intergenic
1000776931 5:165431341-165431363 TCTTCCATTGATAAGGACGAGGG - Intergenic
1000858378 5:166428386-166428408 TTTTCCAATGATAAAGAGGAGGG + Intergenic
1001226300 5:169947324-169947346 TTTTCCAAGGGGAATGAGGAGGG + Intronic
1002416061 5:179121563-179121585 CTTTCCATAGACAGAGAGGAGGG + Intronic
1002592549 5:180300818-180300840 TTTACTATGGGCAAGGAGCAGGG + Exonic
1003725958 6:8764313-8764335 TTTTAGAAGGACCAGGAGGAAGG - Intergenic
1003784703 6:9472019-9472041 TTTTCCATGGAAAAGCAAGATGG + Intergenic
1004177081 6:13349331-13349353 TTTTCCATGGACCAGGGGTCAGG + Intergenic
1005153786 6:22780706-22780728 TCTTCCAAGCAGAAGGAGGAAGG - Intergenic
1005267413 6:24126431-24126453 TTATGCATGAAGAAGGAGGAAGG - Intronic
1005546488 6:26878403-26878425 TATTTCATAGCCAAGGAGGAAGG - Intergenic
1005896703 6:30185228-30185250 ATTTCCATAGCCAAGGAGGTGGG - Exonic
1006595441 6:35189847-35189869 TTTTCCATGGACCAGGAATAGGG + Intergenic
1007346371 6:41232487-41232509 TTTTCCATGGACTTGGAGGTAGG + Intronic
1007401947 6:41607711-41607733 TTTTCCATGGACCAGGGTGGGGG + Intergenic
1007890718 6:45287591-45287613 TTTGCCAGGGACTGGGAGGATGG + Intronic
1008632195 6:53372690-53372712 TGTCCCATAGACAAGGAGGTGGG - Intergenic
1010506176 6:76662067-76662089 TTCTCCATGGACAAGAGGGCAGG + Intergenic
1010740316 6:79495251-79495273 TTTTCCATGGACAGGGTTGAGGG - Intronic
1011637598 6:89388657-89388679 TTTTCCAGGGACCAGTGGGATGG + Intronic
1012046470 6:94281665-94281687 TTTTCCATGGACCTGGGGGTGGG + Intergenic
1013268221 6:108521099-108521121 TTTTCCATGGACCAGGGGCAGGG - Intronic
1014469069 6:121792851-121792873 TTTTCCATGGATAAGGATGAGGG + Intergenic
1014540683 6:122672052-122672074 TTGTCCATCAAAAAGGAGGATGG + Intronic
1014720481 6:124911695-124911717 TTTTCCATGGACAGGGTGGTGGG + Intergenic
1014884549 6:126763812-126763834 TTTTCCATTGATAAAGAGGATGG + Intergenic
1015082787 6:129248227-129248249 TTTTCCATGGACACAGAGGAGGG - Intronic
1015088877 6:129330256-129330278 TTTTCCATGGACTAGGATTGGGG - Intronic
1015646175 6:135391310-135391332 TTTTCCATGGACTTGGGGGCAGG + Intronic
1015761327 6:136664443-136664465 TTTTCCATGGACCAGGGGTGGGG - Intronic
1015770378 6:136762434-136762456 TGTTCCATGGACAAAGATTAGGG + Intronic
1015832783 6:137387962-137387984 TTTTCCACGGACCAGGGTGAGGG - Intergenic
1016348127 6:143138172-143138194 TTTTCAGAGGACAAGGATGAGGG - Intronic
1016518052 6:144918796-144918818 TTTTCCATAGACAGGGAGGCAGG - Intergenic
1016785374 6:148005624-148005646 TTTTCCATGGACCAAGAGTGAGG + Intergenic
1017060976 6:150484736-150484758 TTTTCCATGGACCAGGATGTGGG + Intergenic
1017424826 6:154309575-154309597 TTCTCCAAGAACAAGGAGGGCGG - Intronic
1017557057 6:155583066-155583088 TCTGCCATGGGGAAGGAGGATGG + Intergenic
1017741628 6:157411733-157411755 TTTACCATGAACATGCAGGAAGG - Intronic
1017886014 6:158599949-158599971 TTTTCCCGGAACCAGGAGGATGG + Intronic
1017953966 6:159162664-159162686 TCTTCTATGGAGAAGGGGGAAGG + Intergenic
1018305207 6:162447815-162447837 TTGACCAATGACAAGGAGGATGG - Intronic
1019923488 7:4177680-4177702 TTTTCCATAGACCAGGTGGTAGG + Intronic
1020142985 7:5622568-5622590 TATGCCATGGACAAGGCAGAAGG + Intronic
1020962629 7:14825255-14825277 TTTTCCATGGACCAGGGAGTGGG + Intronic
1022001263 7:26228657-26228679 TTTTCCATGGACATGGAATTGGG - Intergenic
1023323584 7:39027486-39027508 ATCTCCATGGAAAGGGAGGAAGG + Intronic
1023491046 7:40742391-40742413 TTTTCCATGGACGGGGATGGGGG + Intronic
1023656588 7:42428781-42428803 TTTTGCAAGGCCAAGGAGGGAGG - Intergenic
1023975613 7:45027780-45027802 TATTCCATGGAGAATGAGGTAGG + Exonic
1024127578 7:46316112-46316134 TCTTTCACGGACAAGGAAGATGG + Intergenic
1024410380 7:49034005-49034027 ATTTCCTTGGAAAAGGAGGTTGG + Intergenic
1025732732 7:64120820-64120842 TATTTCATAGCCAAGGAGGAAGG + Intronic
1025937647 7:66049906-66049928 TTTTCCACTGACTAGGAGGCAGG + Intergenic
1026315989 7:69228048-69228070 TTTTCCATGGACTGAGGGGAGGG + Intergenic
1026465588 7:70650958-70650980 ATTTCAATGGACAGAGAGGAAGG + Intronic
1026555163 7:71401916-71401938 TTTTCCATGGACAGAGCAGAGGG - Intronic
1026558424 7:71427965-71427987 TTTTCCATGGACAAGGGTGGTGG - Intronic
1027567923 7:79821228-79821250 TTTTCCTTGGCCAAGCACGATGG - Intergenic
1027654267 7:80910315-80910337 TTCTCATTGGATAAGGAGGATGG + Intronic
1028263946 7:88700176-88700198 TTTTACATGGGAAAGAAGGATGG - Intergenic
1028473098 7:91225532-91225554 ATTTCCATGGACAAGGGCCAGGG - Intergenic
1029263892 7:99324004-99324026 TTTTCCACGGAAAAGGGGGCAGG + Intergenic
1030115722 7:106060870-106060892 TTTTCCATGAACAAGGAGGATGG + Intergenic
1030720756 7:112868078-112868100 TTTTCCATGGACAGGGGTGAAGG - Intronic
1031184119 7:118454379-118454401 ATTTCCATGTACAAGGAATAGGG + Intergenic
1031581068 7:123475725-123475747 GTGTCCATGGACAGGGAAGATGG - Intronic
1031752200 7:125590121-125590143 TTTTTCATGGTCAAAGAGCAAGG - Intergenic
1032131733 7:129234600-129234622 CTTTCAAAGGCCAAGGAGGAAGG - Intronic
1032231193 7:130076025-130076047 TTTTCCATGGACCGGGATGGTGG + Intronic
1032477739 7:132223887-132223909 TATCCCATGGAGATGGAGGAGGG - Intronic
1033397154 7:140986152-140986174 TTTTCCATGGACCCGGGGGGTGG - Intergenic
1033504885 7:141989965-141989987 TGTTCCATGTAGGAGGAGGAAGG + Intronic
1034008038 7:147496224-147496246 TTTTCCATGGATCAGGAGGTAGG - Intronic
1034253685 7:149713445-149713467 TTTTGCATGGACTGGGAGGGGGG - Intergenic
1034485504 7:151358622-151358644 TTTTCCATGGACAAGGAGGAAGG - Intronic
1034729916 7:153378122-153378144 TTTTCCATGGACCAGGGGAATGG + Intergenic
1035112568 7:156495483-156495505 TTTTCCATGGACAGGGAGTGGGG - Intergenic
1036159721 8:6375895-6375917 GTTTCCATGGACAGGGACTAGGG - Intergenic
1036190810 8:6669181-6669203 TTTTCCATGGACCAGGGTGCAGG - Intergenic
1036692586 8:10953187-10953209 TTTTCCACAGACTAGGAGGGAGG - Intronic
1037086209 8:14853896-14853918 TTTTGTATTGGCAAGGAGGAAGG - Intronic
1037207731 8:16343751-16343773 TTTTCCATGTACCAGGAGTTGGG - Intronic
1037253447 8:16923931-16923953 TTTTCCATGAACACTGGGGATGG + Intergenic
1037266937 8:17073622-17073644 TTTTCCACAGACCAGGAGGGAGG - Intronic
1037333196 8:17764871-17764893 TTTTCTGCGGACCAGGAGGAGGG + Intronic
1037734915 8:21558038-21558060 TTTTCCATGGACCAGGGTTAGGG + Intergenic
1038729755 8:30116362-30116384 TTTTCCATGGACAGGGAGGCGGG + Intronic
1038973681 8:32667858-32667880 TTTTCCATAGATAACGATGATGG + Intronic
1039597356 8:38802511-38802533 TTTTCCATGGACCGGGGAGATGG - Intronic
1041268392 8:56086568-56086590 TGTTCCATGGAAAAAGAGGCTGG + Intergenic
1041322508 8:56628388-56628410 CTATCCATTGAAAAGGAGGAAGG - Intergenic
1041846552 8:62335785-62335807 GTTTTTATGGAAAAGGAGGATGG - Intronic
1042124720 8:65526795-65526817 TGTTAAATGGACAAGGATGAGGG - Intergenic
1042172355 8:66004526-66004548 TTTTCCATGGACCAGGAGTAGGG - Intergenic
1042273168 8:66976389-66976411 TTTTCCATGGACCAGAAGTGTGG - Intronic
1042289734 8:67157070-67157092 TTTTCCATGGAGTAGGAAGAAGG + Intronic
1042724597 8:71860200-71860222 TTTTCTCTGGACTAGGGGGAAGG - Intronic
1043347961 8:79322236-79322258 GTGTTCATGGATAAGGAGGAAGG + Intergenic
1044191679 8:89326453-89326475 TTTGACAAGGACAAGGGGGAAGG - Intergenic
1044503418 8:92989745-92989767 TTTTCCATGGACCAGGCTGAGGG - Intronic
1045333979 8:101181747-101181769 TTTTCCATGGACAGGGTTGGGGG + Intronic
1046382303 8:113467263-113467285 TTTTCCTTGGAATAGGAGCATGG + Intergenic
1046524551 8:115367775-115367797 TTTTCCACGGAATAGGAGGTTGG - Intergenic
1046759857 8:118009813-118009835 TTTTTCACGGACCAGGAGGGTGG - Intronic
1047301658 8:123618703-123618725 TTTTCCAAGGACCAGGGGCAGGG - Intergenic
1047389386 8:124437810-124437832 TTTTCTATCAACCAGGAGGAAGG + Intergenic
1048044782 8:130763336-130763358 TTTTCCATGCACCAGGTGGGGGG + Intergenic
1048480255 8:134783472-134783494 TTTTCCATGGACAGGGGTAAGGG - Intergenic
1049285827 8:141774730-141774752 TTTTCCTTGGAGAGGGAGGCTGG + Intergenic
1049459303 8:142716217-142716239 TTTTCCATGGATGAGGCAGAAGG + Intergenic
1049626024 8:143621765-143621787 TTTTCCATGGACCAGGGCGGGGG + Intergenic
1049665256 8:143840168-143840190 CTAGCCATGGACACGGAGGAGGG - Exonic
1050412750 9:5383440-5383462 TTTTCCATGGACCAGGTTGACGG + Intronic
1050501459 9:6302457-6302479 CTGTTCATGAACAAGGAGGAAGG - Intergenic
1051306174 9:15712320-15712342 GTTACCAGGGACAAGGAGGAAGG - Intronic
1051306502 9:15716099-15716121 GTTACCAGGGACAAGGGGGAAGG - Intronic
1051498207 9:17748657-17748679 TCTTCCATGAACCAGGAGGTAGG + Intronic
1051605932 9:18917824-18917846 TCATCCATGGAGAAGGATGAGGG - Intergenic
1051833125 9:21303442-21303464 TTTGCCATGGAAATGGAGGGGGG - Intergenic
1052390386 9:27872339-27872361 TTTTCCATGGACCAGGGTGTGGG + Intergenic
1054450842 9:65402903-65402925 TTTCCAGTGGAGAAGGAGGAGGG - Intergenic
1054978618 9:71177359-71177381 TTTTCCATAGACCAGGGGTAGGG - Intronic
1055399260 9:75905848-75905870 TTTTCCATGGACAGGGGAGGGGG - Intronic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1056046355 9:82721451-82721473 TTTTACTTGGAGAAGCAGGAGGG - Intergenic
1056132506 9:83600194-83600216 ATTTCCATGGGAAAGGAGGCTGG + Intergenic
1056406026 9:86275981-86276003 TTTTCCACGGATAAGGGGAATGG + Intronic
1056492411 9:87120613-87120635 TTTTCCAAGAACAAAGGGGAGGG - Intergenic
1056512638 9:87320343-87320365 TTTTCCATGGACAAGGGTGGAGG + Intergenic
1056526101 9:87444361-87444383 TTTTTCATGCACATGGAGGAGGG - Intergenic
1057020678 9:91695058-91695080 TTTTCCATGGACAAGGGACGGGG - Intronic
1057108775 9:92447144-92447166 TTTTCCACGGACAGGCATGAGGG + Intronic
1057217363 9:93236394-93236416 TTTCCCAAGGTCAGGGAGGAGGG - Intronic
1058091748 9:100813715-100813737 TGTTCCATGGAGCAGGAGGCTGG + Intergenic
1058131069 9:101254092-101254114 TTTTCCATGGACCAGGGGATAGG + Intronic
1058779317 9:108317526-108317548 TTTTCCATGGATGAGGTGGTGGG - Intergenic
1058944520 9:109843654-109843676 ATTTCCAGGGAGAAAGAGGATGG - Intronic
1059359915 9:113734227-113734249 TTTTCCATGGACAGGGGGTTGGG - Intergenic
1059499234 9:114737037-114737059 TTTTCCACTGACAAGGTTGAGGG + Intergenic
1059790512 9:117637088-117637110 TCTGCCATTGACAAGGAAGATGG + Intergenic
1059800605 9:117746022-117746044 TTTTCCATGGACAGGAGGGAGGG + Intergenic
1060503590 9:124181205-124181227 TTTTCCATCCACAGGCAGGATGG + Intergenic
1060791288 9:126487320-126487342 TTCTCTGTGGACAAGGAGAACGG - Intronic
1060980669 9:127789773-127789795 GTTTCCATGGGGTAGGAGGATGG + Exonic
1061625965 9:131840855-131840877 GTTTCACTGGACAATGAGGAAGG + Intergenic
1185550651 X:980746-980768 GTGTCCATGGAGGAGGAGGAGGG + Intergenic
1185948834 X:4407791-4407813 TTTTCCATGGACCAGGGGTTAGG + Intergenic
1186472178 X:9830321-9830343 TTTGCCATGTACACGGAGCAGGG + Intronic
1186592329 X:10944095-10944117 TTTTCCATGGACCAGGGAGGGGG + Intergenic
1188217520 X:27497467-27497489 TTTGCCAAGGGCAAGAAGGATGG - Intergenic
1188375987 X:29428686-29428708 TGTCCCATGGACAAAGATGAAGG + Intronic
1189115189 X:38335051-38335073 TTTTCCATGGACCAGAGGGTGGG - Intronic
1189213281 X:39302594-39302616 TTTTCCATGGACAGGGTGGAGGG - Intergenic
1189344196 X:40228153-40228175 TTTTCCACAGACAGGGAGGTGGG + Intergenic
1189373916 X:40451535-40451557 TTTTCCATGGACAGGGGCGAGGG - Intergenic
1189498130 X:41528558-41528580 TTTTGGATGTACAATGAGGAAGG + Intronic
1189737772 X:44089068-44089090 TTTTGGATGAAGAAGGAGGAGGG + Intergenic
1189880172 X:45482770-45482792 TTTTCCATGGACCATGAGGGAGG + Intergenic
1190001485 X:46692394-46692416 TTTTCCTTGGACAAGCAGGCAGG - Intronic
1190097266 X:47491721-47491743 CTTTCCATGGACATGGAGCGGGG + Intergenic
1190134151 X:47779677-47779699 TTTTCCATGGACCAGGGAGGGGG + Intergenic
1190144030 X:47874287-47874309 TCTTCCATGGCCATGGGGGATGG + Intronic
1191936943 X:66436881-66436903 TTTTCCAGGGAGAAGGAGGCAGG - Intergenic
1192172773 X:68867284-68867306 TTTTCCATGCACACTGAGGCAGG + Intergenic
1192386342 X:70675505-70675527 GTTTCCAGGGGCTAGGAGGAGGG - Intronic
1192678110 X:73221521-73221543 TTTTGCAGGGACAAGGATGCAGG - Intergenic
1192683567 X:73280348-73280370 TTTTCCATGGACTGGGGGGAAGG + Intergenic
1192906056 X:75551818-75551840 TTTTGCAGGGACATGGATGAAGG + Intergenic
1193037271 X:76965715-76965737 TTTTCCACGGACAAGGGAGTGGG + Intergenic
1194783618 X:98055725-98055747 TTTTTCATGGACACAGAGAAGGG - Intergenic
1195884860 X:109627071-109627093 TTTTTCATGGACACTGGGGAGGG - Intronic
1196141258 X:112265795-112265817 TTATGCATGGAGGAGGAGGAAGG - Intergenic
1196786923 X:119428938-119428960 TTTTCCACGGACAAGGGGTTGGG - Intronic
1196872299 X:120124650-120124672 TTTTCCATGGACTTGGTGGGCGG + Intergenic
1197654825 X:129105614-129105636 TTTTCCATGGACTGGGGGGAAGG + Intergenic
1198066801 X:133106249-133106271 TTTTCCACAGACAGGGAGGATGG - Intergenic
1198949556 X:142055279-142055301 TTCTCCATGGGCAACAAGGAGGG + Intergenic
1199283976 X:146035980-146036002 TTTTCCATGGACTGGGAATAGGG - Intergenic
1200491883 Y:3835860-3835882 ATTTCCAAGACCAAGGAGGATGG - Intergenic
1201150407 Y:11092564-11092586 TTTACCATGGGGGAGGAGGAGGG - Intergenic
1201239651 Y:11946505-11946527 TTTTCCATGGAGCAGGATGGGGG - Intergenic