ID: 1034485953

View in Genome Browser
Species Human (GRCh38)
Location 7:151362662-151362684
Sequence GGAGTTAAAGAGATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 313}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034485948_1034485953 -10 Left 1034485948 7:151362649-151362671 CCTTGTGCTCCCTGGAGTTAAAG 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1034485953 7:151362662-151362684 GGAGTTAAAGAGATGGAGCTGGG 0: 1
1: 0
2: 5
3: 38
4: 313
1034485945_1034485953 1 Left 1034485945 7:151362638-151362660 CCCAGGCAGAGCCTTGTGCTCCC 0: 1
1: 0
2: 3
3: 29
4: 233
Right 1034485953 7:151362662-151362684 GGAGTTAAAGAGATGGAGCTGGG 0: 1
1: 0
2: 5
3: 38
4: 313
1034485946_1034485953 0 Left 1034485946 7:151362639-151362661 CCAGGCAGAGCCTTGTGCTCCCT 0: 1
1: 0
2: 1
3: 27
4: 344
Right 1034485953 7:151362662-151362684 GGAGTTAAAGAGATGGAGCTGGG 0: 1
1: 0
2: 5
3: 38
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034485953 Original CRISPR GGAGTTAAAGAGATGGAGCT GGG Intronic
900132093 1:1091587-1091609 GGAGCCAAAGAGATGGAGTGGGG + Intronic
900990854 1:6097601-6097623 AGAGATAAAGGGAGGGAGCTGGG + Intronic
902190141 1:14756684-14756706 GGAGTTGAAGAGATGAAGTTAGG - Intronic
904200828 1:28818066-28818088 GGACTCAAAGAGATCGAGCATGG + Intronic
904392870 1:30197260-30197282 AGAGTTAAGGAGATGGAGATCGG - Intergenic
905812520 1:40923136-40923158 GCAGTTGCAGAGCTGGAGCTGGG + Intergenic
905828645 1:41046729-41046751 GGAGTTAAAGGGAGGGAGGGAGG - Intronic
906257721 1:44363210-44363232 GGAGTTCAACAGGTGGAGATAGG - Intergenic
907766860 1:57421879-57421901 GGAGTGAAAGAGATGGGGGGTGG + Intronic
909434662 1:75627052-75627074 GGACTTTAAAAGATGGAGATGGG - Intergenic
910836237 1:91515358-91515380 TGAGTCAAAGAGTTGGAGGTGGG - Intronic
911011243 1:93283090-93283112 TGAGTTGAAGAGACAGAGCTAGG + Intergenic
911640732 1:100286075-100286097 GGAGTTAAAGAGAAAGGCCTGGG - Intronic
911733973 1:101317318-101317340 GGGGTTACAGGCATGGAGCTGGG + Intergenic
912370200 1:109167902-109167924 GGATTTAAGGAGATGAGGCTGGG - Intronic
912955367 1:114151893-114151915 GGTGGTACAGAGATGGAGGTTGG - Intronic
913327995 1:117644451-117644473 TCAGTTTCAGAGATGGAGCTAGG - Intergenic
913471306 1:119190076-119190098 TGAGGTGAGGAGATGGAGCTGGG - Intergenic
913566423 1:120077259-120077281 GGAGTTGATCAGATGGACCTGGG - Intergenic
913631708 1:120716290-120716312 GGAGTTGATCAGATGGACCTGGG + Intergenic
914287182 1:146237975-146237997 GGAGTTGATCAGATGGACCTGGG - Intergenic
914548214 1:148688717-148688739 GGAGTTGATCAGATGGACCTGGG - Intergenic
914618469 1:149382989-149383011 GGAGTTGATCAGATGGACCTGGG + Intergenic
914731093 1:150370984-150371006 GGAGGTAAAGTGAAGGAGATAGG - Intronic
915203821 1:154254042-154254064 GGTGATGAAGAGATGGAGCTGGG - Exonic
916087685 1:161282585-161282607 TGAGTTAAAGAGAAGGGCCTGGG - Intronic
916452719 1:164936606-164936628 GGAGTTACAGAGTTGAATCTTGG - Intergenic
916668092 1:166985232-166985254 TGAGTTGAGGAGATGGAGGTGGG + Intronic
917557459 1:176105146-176105168 GGAGTAGAAAAGATGGAGGTAGG + Intronic
917596246 1:176532143-176532165 GGAGGTAGAGAGAGGGAGCAGGG - Intronic
917611737 1:176695711-176695733 GGAGATAAAGGGATGGAGATGGG - Intronic
918170839 1:181995905-181995927 GGAGGAAAAGAAATGGAGCAGGG - Intergenic
919846611 1:201646981-201647003 GGAGCTAGAGAGATGGAGGTTGG + Intronic
921689670 1:218133661-218133683 GAAGTCAAATAGATGAAGCTGGG + Intergenic
922564592 1:226593455-226593477 AGGGTAAAAGTGATGGAGCTGGG - Intronic
924832663 1:247614477-247614499 GGAGTCAAAGAGGTGGTGTTTGG + Intergenic
924851603 1:247836857-247836879 GGATTTAAAGAAATGGAGATAGG - Intergenic
1064295045 10:14071597-14071619 GGAGATAAAGAGGTGGAGATGGG + Intronic
1065386849 10:25142555-25142577 GGAGAGAGAGAGATGGAGGTGGG - Intergenic
1067103306 10:43348948-43348970 GGAGAGAGAGAGATGGAGCAAGG + Intergenic
1067728885 10:48794599-48794621 GGAGCTAACCACATGGAGCTGGG + Intronic
1068024847 10:51629874-51629896 GGTTTGAAAGAGATGGAGCCAGG - Intronic
1070323693 10:75373847-75373869 GGAGGTAAGGAGCTGGAGATGGG - Intergenic
1071176471 10:82932103-82932125 GGAGAGAAGGAGATGGAACTTGG - Intronic
1074295606 10:112184740-112184762 TGAGTTGAAGAGATAGAACTGGG + Intronic
1074323855 10:112429093-112429115 GGAGTTAAAGAGAATGTTCTTGG + Intergenic
1075309553 10:121401789-121401811 GGAGGCAGAGAGATGGAGATGGG + Intergenic
1075337395 10:121618096-121618118 GGAGTGAAGGAGGTGGAACTTGG - Intergenic
1075656366 10:124163892-124163914 ATAATTAAAGAGATAGAGCTTGG - Intergenic
1079009553 11:16816963-16816985 GGAGGCACAGAGATGGAGCGGGG + Exonic
1079292111 11:19197470-19197492 GGAGAGAAAGAGATGGAGAGAGG - Intronic
1081015613 11:37875938-37875960 AAAGTTAAAAACATGGAGCTGGG - Intergenic
1083675786 11:64323987-64324009 AGAGTGACAGAGACGGAGCTGGG - Intergenic
1083997603 11:66279824-66279846 GGAGTGACAGGGCTGGAGCTGGG - Intronic
1084646413 11:70461207-70461229 GGAGTGAGACGGATGGAGCTTGG + Intergenic
1087794071 11:102437274-102437296 AGGGTTAAAGAGATGGGGCTGGG - Intronic
1088231731 11:107679923-107679945 TTAGTTAAAGAGCTGGAACTTGG + Intergenic
1088251981 11:107869112-107869134 GGATTAAAAGAGCTTGAGCTAGG + Intronic
1088811072 11:113392906-113392928 GGAGTGAAAGAGAGGGAGAAAGG + Intronic
1089362442 11:117899992-117900014 GGGGGTACAGAGGTGGAGCTGGG + Intergenic
1090046991 11:123344361-123344383 TTAGTTAAAGAGACTGAGCTGGG - Intergenic
1091357844 11:134951601-134951623 GGAGCTAAAGGAGTGGAGCTGGG + Intergenic
1091694864 12:2621652-2621674 GCAGTGGAAGAGATGGAGCGAGG + Intronic
1091990630 12:4952893-4952915 GGAGGAAAAGAGATGGGACTGGG - Intergenic
1095194256 12:39294883-39294905 AGTGTTAAAGAGATAGGGCTCGG - Intronic
1097102007 12:56596482-56596504 CTAGGGAAAGAGATGGAGCTGGG + Exonic
1097153686 12:56997249-56997271 GGAGAGAAAGAGATGGGGGTGGG - Intergenic
1097387755 12:58969923-58969945 CAAGTTAAAAAGATGAAGCTGGG + Intergenic
1097452143 12:59749815-59749837 GGACTTCAAGATATGGATCTTGG + Intronic
1098470548 12:70838518-70838540 GGAGTGAAAGAGAAGAATCTGGG + Intronic
1098779601 12:74670151-74670173 GGAGTTAAAGTCAGAGAGCTAGG - Intergenic
1100608767 12:96173114-96173136 GGTGTTGAAGCCATGGAGCTTGG + Intergenic
1100795286 12:98175788-98175810 GGAGTGAGAGAGATGAATCTTGG - Intergenic
1101228053 12:102709488-102709510 GGAGCAAAAGAGAGGGAGCGGGG + Intergenic
1101684776 12:107008191-107008213 TGAGTTTAGGAGAAGGAGCTGGG - Intronic
1102676342 12:114661886-114661908 TGAATTAAATAGATGGAGATTGG + Intergenic
1105377957 13:19862795-19862817 GGAGTGACAGAGATGACGCTGGG - Intronic
1106145553 13:27046839-27046861 TGAGTTAAAGAGATGGGGGAAGG + Intergenic
1106997689 13:35506779-35506801 GGAGTTAAGAACATGGACCTAGG - Intronic
1107416573 13:40206804-40206826 GGAGTGATAGGGGTGGAGCTAGG - Intergenic
1108517127 13:51214111-51214133 GGAGTTAACCAGATGAAGATGGG + Intergenic
1108543099 13:51462713-51462735 GGAGTTTAAGACATGGAGAACGG + Intergenic
1108590842 13:51911840-51911862 GGAGAGGAGGAGATGGAGCTGGG - Intergenic
1110761476 13:79235405-79235427 TGAGCTAAGGAGATGGAGCTGGG + Intergenic
1113023765 13:105918332-105918354 GGAGTTAAAGTGAGGGTTCTGGG - Intergenic
1113151335 13:107267392-107267414 GGAGGGAAGGAGATGGAGGTGGG + Intronic
1113605282 13:111600362-111600384 GGAGGTAAAGACAAGGGGCTGGG + Intronic
1114613222 14:24055401-24055423 GGAGTTGGGGAGATAGAGCTGGG - Intronic
1116651891 14:47604251-47604273 GGAGAGAAAGGGATGGAGGTGGG - Intronic
1116722881 14:48523339-48523361 GGTGTTTAAGAGGTGGAGCTTGG - Intergenic
1118850500 14:69579417-69579439 GGAGGCAAAAAGATGGGGCTGGG + Intergenic
1119092314 14:71796115-71796137 GGATTTCAAGAGATAGATCTGGG + Intergenic
1119660421 14:76447513-76447535 GGTGTGAAAGGAATGGAGCTTGG - Intronic
1120017348 14:79488918-79488940 GGAGGAAAAAAGATAGAGCTAGG - Intronic
1121006612 14:90494744-90494766 GGAGTGACAGAGATGGAACTGGG - Intergenic
1122419830 14:101568514-101568536 GGAGATAGAGAGGTGGAGCCGGG + Intergenic
1124001082 15:25760683-25760705 GGAATTAATTACATGGAGCTGGG + Intronic
1125365064 15:38904866-38904888 GGAGTTAATTAGGTGGTGCTGGG - Intergenic
1125523409 15:40360530-40360552 GGAGTTAAAGGGAAGGAGCTGGG + Intronic
1125695605 15:41634792-41634814 GAAGTTAAAGAGAGGGAGGGAGG + Intronic
1126181949 15:45793954-45793976 GGGGGCAAAGAGATGGAGATGGG + Intergenic
1130866264 15:87935692-87935714 TGATTTAAAGAGATGGAGAGAGG - Intronic
1133872548 16:9702714-9702736 GGAGGTAATGAGCTGCAGCTTGG + Intergenic
1134261407 16:12654074-12654096 AGTGTTAAAGGGATGGAGTTGGG - Intergenic
1134649916 16:15900172-15900194 AGACTTAAAGTGGTGGAGCTGGG + Intergenic
1135112032 16:19697854-19697876 GGAGTCAGAGAGCTGGAGCTCGG + Intronic
1136907960 16:34119709-34119731 TGAGTTGAGGAGATGAAGCTGGG - Intergenic
1138138867 16:54549205-54549227 AGATTGAAAGAGATAGAGCTTGG - Intergenic
1138505573 16:57476693-57476715 TGAGGTAAAGGGGTGGAGCTAGG + Intronic
1138908011 16:61361502-61361524 TGAGGTCAGGAGATGGAGCTGGG - Intergenic
1139460092 16:67115093-67115115 GGAGTTCAAGAGAAGGAGGGTGG + Intronic
1140239283 16:73186385-73186407 GCAGTTACAGAGAGTGAGCTAGG - Intergenic
1140418534 16:74796178-74796200 TCAGTTGAAGAGATGGAGCTGGG + Intergenic
1141157884 16:81609805-81609827 GGAGATGGAGAGATGGAGTTTGG + Intronic
1141743660 16:85911605-85911627 GAAGTTACAGAGATGGAGTGCGG + Exonic
1143595289 17:7910362-7910384 GGAAATACAGAGATGGAGCCAGG - Intronic
1144112534 17:12050045-12050067 GGAGTTGAAGATATGCAGATTGG + Intronic
1144420610 17:15094665-15094687 AGAGTTAAAGAGAGGTAGCCAGG + Intergenic
1148065922 17:44869732-44869754 CGAGGGAAAGAGATGGGGCTTGG - Intronic
1148767258 17:50046581-50046603 GGAGTTAAGGAGATCCACCTGGG - Intergenic
1149354389 17:55824952-55824974 GGAGTAAGAGAGAGGGATCTGGG + Intronic
1151503856 17:74513172-74513194 GGAGTTAAGGAGAATGTGCTGGG + Intergenic
1153192355 18:2555992-2556014 TGAGTTAAGGAGATGGAGCTTGG + Intronic
1153603555 18:6807840-6807862 TGAGTTTAGGAAATGGAGCTGGG - Intronic
1154316346 18:13306854-13306876 GGATTTCAAGATATGGATCTTGG + Intronic
1154497057 18:14969551-14969573 GGAGCTAAAGGAGTGGAGCTGGG - Intergenic
1156009498 18:32480177-32480199 GGAAATAAAGATCTGGAGCTTGG + Intergenic
1156038393 18:32792630-32792652 GGATTTCAAGATATGGATCTTGG - Intergenic
1158507003 18:58055646-58055668 GGAGTTGGAGAGATAGAGCAAGG + Intronic
1158531485 18:58266546-58266568 GGAGTGAAAGAGCTGGAGTGGGG - Intronic
1159067035 18:63581472-63581494 GGATTTCAAGATATGGATCTTGG + Intergenic
1159263790 18:66052078-66052100 GGAGATGAAGAGATAGAGTTGGG - Intergenic
1159545863 18:69839188-69839210 GGAGCTAAGGAGATGAGGCTCGG - Intronic
1160086436 18:75781111-75781133 AGAGTGAAGGAGAAGGAGCTGGG - Intergenic
1165137671 19:33680117-33680139 GGAGATACCGAGATGGAGTTTGG - Intronic
1165326787 19:35118693-35118715 GGGGGAACAGAGATGGAGCTAGG + Intronic
1166920265 19:46224408-46224430 GGAGAGAAAGAGAGGGAGCAGGG - Intergenic
1168447525 19:56433618-56433640 CGAATTAAGGTGATGGAGCTGGG + Intronic
927517370 2:23680222-23680244 GGAGGTAAAAAGATGGGACTTGG + Intronic
928816354 2:35299295-35299317 AGAACTTAAGAGATGGAGCTTGG + Intergenic
930013244 2:46953961-46953983 GGGTCTCAAGAGATGGAGCTTGG - Intronic
930489407 2:52049363-52049385 GTTGGTAAAGAGATAGAGCTGGG + Intergenic
930997552 2:57738990-57739012 GTAATTAAAGAGATAAAGCTTGG + Intergenic
931607159 2:64064153-64064175 GGAGTTAAAGAAAGGAAGCTGGG + Intergenic
932789108 2:74637950-74637972 TGAGTCAAGGAGATGGATCTGGG - Intronic
934847021 2:97668051-97668073 GAAGCAAAAGAGATGGAGCCCGG + Intergenic
934904232 2:98185063-98185085 GGAGTGGTAGAGATGGAGTTGGG - Intronic
936118100 2:109718556-109718578 GGAGGTAGAGAGATGGATCAAGG + Intergenic
937328280 2:121005316-121005338 GTAGGTAAAGAGATGGGGCTGGG - Intergenic
939901516 2:147856182-147856204 GGTGGTAAAGAGGTGGTGCTTGG + Intronic
939993720 2:148900737-148900759 GGGGACAAAGAAATGGAGCTTGG + Intronic
940243103 2:151584640-151584662 TGGCTTAAAGAGTTGGAGCTGGG + Intronic
940244058 2:151595192-151595214 TGGCTTAAAGAGTTGGAGCTGGG + Intronic
940245016 2:151605744-151605766 TGGCTTAAAGAGTTGGAGCTGGG + Intronic
941128013 2:161610329-161610351 TGAGTTGAAGAGATGAAGCTGGG - Intronic
941707592 2:168676135-168676157 GGACTTAAAGATATGTAGTTGGG + Intronic
941827556 2:169916977-169916999 GGAGGTAAAGAGAGGGAGCAGGG - Intronic
942707872 2:178797543-178797565 GGATTAAAAGAAATGGATCTGGG - Intronic
945968171 2:216210212-216210234 AGAGTTTTAGAGATGGAGGTGGG + Intergenic
946060566 2:216937440-216937462 GGAGATAAGGAGATGAAGCAGGG - Intergenic
947515687 2:230801978-230802000 GGAATTAAGGAGATGGAGAGGGG + Intronic
947615335 2:231552935-231552957 TGAGGTAAAGAAATGGAGTTGGG - Intergenic
948014283 2:234675213-234675235 AGAGTTAAGTAGATGGAGTTTGG + Intergenic
948287239 2:236795361-236795383 GGGTTTAAAGAAATGGAGTTTGG + Intergenic
1168974985 20:1958078-1958100 TGAGTTGAAGAGATGGAGCTGGG + Intergenic
1169832727 20:9841749-9841771 GAAGGTAAAGAGAATGAGCTGGG - Intergenic
1170557466 20:17526257-17526279 GGAGTTACAGAGATGGATGTTGG - Intronic
1170776428 20:19378786-19378808 GGAATTAAAGAGTTAGATCTTGG + Intronic
1171136190 20:22696635-22696657 TGAGTTTAGAAGATGGAGCTGGG - Intergenic
1172548632 20:35781623-35781645 GGAGTTACGGAGATGGAGAGTGG - Intronic
1172780676 20:37435357-37435379 TGAGAAAAAGAGAGGGAGCTAGG - Intergenic
1174724361 20:52845718-52845740 GGGGATTAAGAGATGGAGTTTGG - Intergenic
1175119952 20:56709737-56709759 GTGGTTAAAGAGCTGGAGATGGG - Intergenic
1175656172 20:60772906-60772928 CCAGCTAAAGAGATGGAGCAGGG + Intergenic
1176366812 21:6038178-6038200 GGAGTAAAAGAGCAGGTGCTGGG - Intergenic
1176972959 21:15288113-15288135 GGGCTTAGAGAGATGGAGTTAGG - Intergenic
1177316144 21:19463669-19463691 TGAGTTGAGGAGATGGAGCTGGG + Intergenic
1178250948 21:31002962-31002984 GAAGTTCAAGAGATAGAGGTGGG - Intergenic
1178580580 21:33834795-33834817 GTAGGTCATGAGATGGAGCTGGG + Intronic
1178692508 21:34761319-34761341 GGAGTTAAGGAGATGGTCCCTGG - Intergenic
1179526717 21:41982648-41982670 TGAGTTGAGGAGATGGAGCTGGG + Intergenic
1179756706 21:43500366-43500388 GGAGTAAAAGAGCAGGTGCTGGG + Intergenic
1180318475 22:11298999-11299021 TGAGTTGAGGAGATGAAGCTGGG + Intergenic
1180336788 22:11584232-11584254 TGAGTTGAAGAGATGAAGCTGGG - Intergenic
1181621354 22:24093647-24093669 GGAGTTTGAGATATAGAGCTGGG + Intronic
1181870904 22:25898543-25898565 GGAGTTGAAGTGAGGGAGTTAGG - Intronic
1182088749 22:27579756-27579778 GGATTGAATGAGATGGGGCTGGG + Intergenic
1182786272 22:32910293-32910315 TGGGTTAAAGAGATGGGGGTGGG + Intronic
1183093071 22:35536618-35536640 GTAGACAAAGAGATGGGGCTGGG - Intergenic
1183292706 22:37012548-37012570 GGGCTCAAAGAGATGGAGATAGG - Intronic
1183321681 22:37168820-37168842 GGAGGGAAGGAGATGGAGCTGGG - Intronic
1183515708 22:38264643-38264665 GGAGTTGAGGAGATGGAGGCGGG + Intronic
1183563825 22:38598331-38598353 GTAGATAAAGATATTGAGCTTGG + Intronic
949167066 3:955662-955684 GAAGTCAAAGGAATGGAGCTGGG - Intergenic
949711058 3:6871955-6871977 GGAGTGGAGGAGAGGGAGCTAGG - Intronic
950011712 3:9728849-9728871 GAGGTCAGAGAGATGGAGCTGGG - Intronic
951324823 3:21288623-21288645 AATGTTAAAGAGATGGAGATGGG - Intergenic
951705375 3:25539309-25539331 GGAGTTAAATAGGTAGAGGTGGG - Intronic
951741105 3:25924588-25924610 GGAGCTCAAAAGATGAAGCTTGG + Intergenic
952157149 3:30655748-30655770 GGATTTAAGGAGATGATGCTTGG + Intronic
952567820 3:34680018-34680040 TGAGTGAAAGAGATGGTCCTGGG + Intergenic
952855452 3:37766909-37766931 GGAGTTAAAGCGATACAGATGGG - Intronic
953477187 3:43215475-43215497 GGAGGAAAAGAGATGGAGAAGGG + Intergenic
954870060 3:53761075-53761097 GAAGTTGAACAGATGGAGTTGGG + Intronic
955080920 3:55657125-55657147 GGAGTGAAAGAGGAGGATCTTGG - Intronic
955882405 3:63561490-63561512 GAAGTTAGAGAGGTGGAGATAGG + Intronic
956877416 3:73477353-73477375 TGAGTTAAGAAGATGGATCTTGG - Intronic
957857768 3:85899996-85900018 TGAGTTAAGGTGATGAAGCTGGG - Intronic
957979965 3:87496026-87496048 GGGTTTAAAGATATGGATCTTGG - Intergenic
959785177 3:110288330-110288352 GAAATTAAAAAGATGGGGCTGGG - Intergenic
959909853 3:111751674-111751696 GGAGGTAAAGAGATTTTGCTGGG + Intronic
960178207 3:114542533-114542555 GGAATTAAAGAGGAGGGGCTGGG + Intronic
960467646 3:118017006-118017028 GGAGATGAAGAGATGGCACTTGG + Intergenic
960592652 3:119380549-119380571 AGAGGTAAAGAGATAGAGATAGG - Intronic
963169422 3:142235920-142235942 GGAGTTGAAAAGATTGATCTGGG + Intergenic
963306416 3:143658654-143658676 GAAGTCAAAGGGATGGAGGTGGG - Intronic
963463437 3:145646764-145646786 GGAGTCAAATAAATGGTGCTGGG + Intergenic
963631209 3:147732402-147732424 GGAGAGAAAGAGATGCAGGTGGG - Intergenic
963781674 3:149492640-149492662 GGAGGTAAAGAGTTGCAGCCTGG - Intronic
964305836 3:155338673-155338695 GGAGTTGAAGAGATGGAAATTGG - Intergenic
964411140 3:156399015-156399037 GGTATTAAAGAGAGAGAGCTTGG - Intronic
964901425 3:161663750-161663772 AGAGTTGAAGAGATGGGGCTAGG + Intergenic
965425381 3:168516454-168516476 GGAGAAAAAGAGAAGGAGCCAGG - Intergenic
965491073 3:169337463-169337485 TGAGTTAAAAAGATGGAGGTTGG - Intronic
966422862 3:179751169-179751191 GGAGTGAATGAGCTGGAACTAGG + Intronic
970524067 4:16913651-16913673 GGACTTAAAGAGATCGTGGTTGG + Intergenic
971086757 4:23286736-23286758 GGAGTTCAAGAAAGGGATCTTGG - Intergenic
972520583 4:39851634-39851656 AGAGATAAAAAGATGGAGCTAGG + Intronic
973653445 4:53020790-53020812 GGATTAAACAAGATGGAGCTAGG + Intronic
975072610 4:70160369-70160391 TGAGTTAAGTAGATGGAGCCAGG - Intronic
978158882 4:105522020-105522042 GGATTCAAAGAGAGGGAACTAGG - Intergenic
978343884 4:107745590-107745612 TGAGTTAAGGATATGAAGCTGGG - Intergenic
978533945 4:109741263-109741285 AGAGTTGCAGAGATGCAGCTTGG + Intronic
979632154 4:122915388-122915410 TGAGCTAAAGAGGTGGAGGTCGG + Intronic
979851868 4:125581594-125581616 GTATTTAAAGAGATTGAGTTTGG + Intergenic
979922500 4:126517237-126517259 TGAGTTAAGGAGACAGAGCTTGG + Intergenic
980246586 4:130253122-130253144 TGATTTAAAGAGATGAGGCTGGG + Intergenic
981279099 4:142936529-142936551 GGAGCTAAAGAGAGGGAGGGAGG - Intergenic
981571687 4:146158354-146158376 GGATTTCAAGAAATGGATCTTGG + Intergenic
982952337 4:161715654-161715676 GGAGCTATTGAGATGGAACTTGG - Intronic
983116324 4:163821026-163821048 GAAGTTAGAGAGGTGGAGCCAGG - Intronic
985119989 4:186630778-186630800 GGAGTACAAGAGGTGGAGCCGGG + Intronic
987241600 5:16005857-16005879 GAAGTCAAGGAGATGGAGCCAGG - Intergenic
988111548 5:26828821-26828843 AGAGTTAAAGAAATAGAGCAAGG - Intergenic
989371413 5:40712708-40712730 GGAGTTTAAGATATAGAACTGGG - Intergenic
989408262 5:41086693-41086715 TGAGTTGGAGAGATGGAGCTGGG - Intergenic
990804462 5:59643246-59643268 TAAGTTGAGGAGATGGAGCTGGG + Intronic
990930137 5:61079827-61079849 TAAGTTAAGAAGATGGAGCTGGG - Intronic
992371761 5:76151167-76151189 GGACTTGCAGAGATGGAGCTGGG + Intronic
993149994 5:84149109-84149131 CTAGTGAAAGAGAGGGAGCTGGG + Intronic
993397754 5:87412261-87412283 GAAGTTACAGAGATGGTGCGTGG - Intronic
994306357 5:98210070-98210092 TGAGTTAAACAGAAGGGGCTAGG - Intergenic
994433495 5:99698596-99698618 TGAGTTAAGGAGATGTAACTGGG + Intergenic
995061645 5:107817184-107817206 GGAGCTCCAGAGATGGAGGTGGG + Intergenic
995216926 5:109606007-109606029 GGAGTTGAAGAGATAAAGCTGGG + Intergenic
995389593 5:111625931-111625953 TGAGTTAAAGAGATGAAGCTGGG + Intergenic
995881897 5:116852585-116852607 GGATTTGAAGAGACAGAGCTGGG + Intergenic
996471282 5:123863932-123863954 GCAGCTAATGGGATGGAGCTGGG - Intergenic
996471671 5:123868171-123868193 GGAGCTAAGGAGATGGATCTGGG + Intergenic
997441859 5:133914138-133914160 GGAGTTAAAAGCATGGACCTTGG - Intergenic
999222237 5:149989971-149989993 GGAGTTAGGGAGATGGGGCTGGG - Intronic
999380368 5:151117223-151117245 GGTGGTACAGAGATGGAGATGGG - Intronic
999494636 5:152085074-152085096 GGATTTAATTAGATGGAGTTGGG + Intergenic
1002094504 5:176823110-176823132 GGAGTAAGAGAGATGGATGTGGG + Intronic
1003314585 6:5001002-5001024 GGAGTGAACTAGCTGGAGCTTGG - Intronic
1003427398 6:6006888-6006910 GGAGAGAAAGAGAGGGAGCGAGG + Exonic
1003781300 6:9430136-9430158 GCTGTGAAAGAGATGGAGCGGGG - Intergenic
1004336971 6:14772507-14772529 GGAGGCAAAGAGATGGGTCTGGG - Intergenic
1004535117 6:16492901-16492923 GAAATTAAAGAGGAGGAGCTGGG - Intronic
1005120086 6:22380066-22380088 GGAGACAAAGAGATGGGGCAGGG - Intergenic
1005695396 6:28347173-28347195 GAAGTTAAAGAAATAGGGCTAGG - Intronic
1005810833 6:29514757-29514779 GGAGTGAAAGAGAAGGTTCTGGG - Intergenic
1006888340 6:37400832-37400854 GGGGTTAAAGTGATGGAACTTGG + Intergenic
1006944809 6:37778187-37778209 GGAGGCAAAGAGGAGGAGCTGGG - Intergenic
1007114339 6:39332875-39332897 TGAGTTGAGGAAATGGAGCTGGG - Exonic
1007732813 6:43959435-43959457 GGATTTCAAGATATGGATCTTGG + Intergenic
1013798703 6:113915004-113915026 TGAGCTGAGGAGATGGAGCTGGG - Intergenic
1015266264 6:131294980-131295002 GGAGTGGAGGAGACGGAGCTTGG + Intergenic
1016057611 6:139594815-139594837 GAAGGTAAATAGGTGGAGCTTGG + Intergenic
1016861378 6:148721937-148721959 GGAGCTAAGGAGAGGGAGCAGGG - Intergenic
1016976712 6:149815876-149815898 TCAGTTAAAAAGATGAAGCTGGG - Intergenic
1017699917 6:157058779-157058801 GCAGTTGGAGAGATGGGGCTGGG + Intronic
1018311687 6:162516269-162516291 GGAGTTAGGGAGAAGGAGCTGGG - Intronic
1020030964 7:4932310-4932332 GGAGTTAAAGGGAAAGTGCTCGG - Intronic
1020231494 7:6322507-6322529 TGAATTAAAGAGCTGCAGCTGGG + Intergenic
1020475809 7:8593037-8593059 TGAGTTAAAGAAATGGACCTTGG - Intronic
1021147133 7:17102840-17102862 GGAGTTATAGAGCTGAACCTAGG - Intergenic
1021966416 7:25924182-25924204 GGATTACAAGAGGTGGAGCTAGG - Intergenic
1022421778 7:30230166-30230188 GGAGTACAGCAGATGGAGCTTGG + Intergenic
1022492708 7:30833061-30833083 GGACTTAAAAACATGGTGCTGGG - Intronic
1022855849 7:34313350-34313372 TGAGTTAAAGAGATGAGGCCGGG - Intergenic
1023291251 7:38671220-38671242 GGAGTTTCAGAGAGGAAGCTAGG - Intergenic
1023340634 7:39215669-39215691 GGAGTGAAGTAGATGGAGGTGGG + Intronic
1026221522 7:68402104-68402126 GAAGTTGATGAAATGGAGCTTGG - Intergenic
1026387737 7:69867211-69867233 TGAGTTGATGAGATGGAGTTTGG + Intronic
1027437604 7:78181214-78181236 TGAGGTAAAGAGATGGCCCTTGG - Intronic
1027935429 7:84595823-84595845 GGAGGAAGAGAGATAGAGCTGGG - Intergenic
1028254909 7:88583046-88583068 TGAGTTGCAGAGATAGAGCTAGG - Intergenic
1028910169 7:96199083-96199105 GGATTCAAAGAGATGAAGCAGGG - Intronic
1030351545 7:108494024-108494046 TCAGTTAAATAAATGGAGCTGGG + Intronic
1030764261 7:113389589-113389611 TGAGTTGAAGAGATGGATTTGGG + Intergenic
1030779466 7:113581591-113581613 GGCATAAAAGAGATGGAGGTAGG - Intergenic
1030849494 7:114465507-114465529 AGCCTTAAAGAGATGGAGTTGGG + Intronic
1031640165 7:124153328-124153350 GGAGTTACAAAGATAGAGCCTGG + Intergenic
1031965426 7:128024792-128024814 GCACTTAAAGAGTTAGAGCTGGG + Intronic
1032150657 7:129426754-129426776 GGAGATAGAGAGGTGGAGTTTGG + Intronic
1033144473 7:138859593-138859615 TGAGTTGAAGAAATGGAGTTTGG - Intronic
1033591059 7:142808922-142808944 TGACTGTAAGAGATGGAGCTAGG - Intergenic
1033606271 7:142930317-142930339 GGATTTAATGGGATGGAGGTGGG - Intronic
1033931786 7:146532043-146532065 GGCGATAAAGAGCTGGAACTAGG + Intronic
1034485953 7:151362662-151362684 GGAGTTAAAGAGATGGAGCTGGG + Intronic
1039243730 8:35584750-35584772 GGAGATAAAGAGATCCAGTTAGG - Intronic
1041365527 8:57099606-57099628 GGAGGAAAGGAGATGGGGCTGGG - Intergenic
1041626495 8:60034778-60034800 AGAGATAAAGAGAAGGAGGTAGG - Intergenic
1042517065 8:69670836-69670858 GGAGTTAAAGATATGTAGATTGG - Exonic
1043027317 8:75086054-75086076 AGAGTAAAAGAGATGGAAATGGG + Intergenic
1043830495 8:84982765-84982787 GAAATTAAAGAGAGGGAGGTTGG + Intergenic
1044513874 8:93116096-93116118 TCAGTTAAAGAGATGGAGCTGGG - Intergenic
1044523603 8:93226840-93226862 GAAGTTTAAGAGACAGAGCTTGG - Intergenic
1045872133 8:106939158-106939180 GGTGTTATAGAGCTGGAGCTGGG + Intergenic
1046567040 8:115914954-115914976 GGAGGTATGGAGATGGAGGTAGG + Intergenic
1047756469 8:127922763-127922785 GGAAGTAAAGAGATGGGCCTGGG - Intergenic
1047782923 8:128124383-128124405 GGAGTTAGAGAGATGGGGGAGGG - Intergenic
1048029262 8:130615677-130615699 GCAGTGGAAGAGATGGAGCCCGG - Intergenic
1048383537 8:133889974-133889996 GGAGTTAATGAGATAGTGTTTGG + Intergenic
1048775495 8:137941562-137941584 GGAGTTTCAGAGCTGGAGCTGGG + Intergenic
1050211040 9:3256410-3256432 GAAGTTAAATAGATGGTTCTGGG + Intronic
1050445611 9:5718797-5718819 GAAGTTCAAGAAATAGAGCTGGG + Intronic
1051193567 9:14538924-14538946 GGAGTGAAAGAGGTGGGGTTGGG - Intergenic
1051229076 9:14935105-14935127 GGAATTACGGAGAAGGAGCTGGG + Intergenic
1051780964 9:20688522-20688544 GGAGTTAAAGAGAGGATTCTAGG + Intronic
1052119407 9:24692285-24692307 GGAGAGAAAGAAGTGGAGCTGGG + Intergenic
1054957366 9:70928116-70928138 GGAGTCAGAGAGATAGATCTAGG + Intronic
1055196221 9:73597571-73597593 AGAGAAAAAGAGAAGGAGCTAGG + Intergenic
1055955657 9:81771066-81771088 GGAGTTAAATAAGTGGTGCTTGG + Intergenic
1055959929 9:81810633-81810655 GTAAATAAATAGATGGAGCTGGG + Intergenic
1056527320 9:87455411-87455433 AGAGTGCAAGAGATGAAGCTTGG - Intergenic
1056898151 9:90570757-90570779 GGAGTGAGGGAGATGGATCTGGG - Intergenic
1057183586 9:93043076-93043098 GGAGAAAAAGAGAGGGATCTGGG + Intergenic
1057718821 9:97516490-97516512 GGAGCTTAGGAGTTGGAGCTTGG + Intronic
1058296936 9:103320636-103320658 GGAGTTAATGAGATGCTGCATGG - Intergenic
1058628974 9:106966491-106966513 GGAGTGAGAGAGATGGAGAGGGG - Intronic
1060931412 9:127491707-127491729 GGAGTTACACAGATGCGGCTGGG - Intronic
1203366708 Un_KI270442v1:264759-264781 TGAGTTGAGGAGATGAAGCTGGG + Intergenic
1186787637 X:12968462-12968484 GGGGTTAAAGAGGAGGAGCATGG + Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1187979185 X:24736748-24736770 AGAGTTACAGAGATGGATCGTGG - Intronic
1188277421 X:28217525-28217547 CGAGTTGAGGAAATGGAGCTAGG + Intergenic
1188919051 X:35948942-35948964 AGAATTAAAAAGATGGAGGTGGG + Intronic
1189056671 X:37706533-37706555 GCAGATAAAGAGATTGAGGTTGG + Intronic
1189419099 X:40840501-40840523 TGAGTTGAAGAGATGAAGATTGG - Intergenic
1191756589 X:64599284-64599306 GGAGTTCCAGAGAGGTAGCTTGG + Intergenic
1192305815 X:69958414-69958436 GCTATTAAAGAGATGGAGCCAGG + Intronic
1192936984 X:75870651-75870673 AGAGTGAAAGAGTTGAAGCTTGG + Intergenic
1194417877 X:93636063-93636085 GGAGTGAAGGAGATGGAGGTGGG - Intergenic
1197721338 X:129746743-129746765 GGATATAAAGAAATGGACCTTGG + Intronic
1199701927 X:150386069-150386091 GGATTTCAAGATATGGATCTTGG - Intronic