ID: 1034487633

View in Genome Browser
Species Human (GRCh38)
Location 7:151375968-151375990
Sequence CAGCTTGGACAGCCTCGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034487622_1034487633 21 Left 1034487622 7:151375924-151375946 CCCAGGAAAACATTGACCGAGTG 0: 1
1: 0
2: 2
3: 4
4: 89
Right 1034487633 7:151375968-151375990 CAGCTTGGACAGCCTCGGGTGGG 0: 1
1: 0
2: 0
3: 14
4: 123
1034487623_1034487633 20 Left 1034487623 7:151375925-151375947 CCAGGAAAACATTGACCGAGTGA 0: 1
1: 0
2: 2
3: 12
4: 84
Right 1034487633 7:151375968-151375990 CAGCTTGGACAGCCTCGGGTGGG 0: 1
1: 0
2: 0
3: 14
4: 123
1034487621_1034487633 25 Left 1034487621 7:151375920-151375942 CCTTCCCAGGAAAACATTGACCG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1034487633 7:151375968-151375990 CAGCTTGGACAGCCTCGGGTGGG 0: 1
1: 0
2: 0
3: 14
4: 123
1034487625_1034487633 5 Left 1034487625 7:151375940-151375962 CCGAGTGAGTGACAGGCCTTTGT 0: 1
1: 0
2: 3
3: 15
4: 162
Right 1034487633 7:151375968-151375990 CAGCTTGGACAGCCTCGGGTGGG 0: 1
1: 0
2: 0
3: 14
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034487633 Original CRISPR CAGCTTGGACAGCCTCGGGT GGG Intronic
901018658 1:6245252-6245274 CACCATGGACAGCGCCGGGTTGG + Exonic
902482134 1:16717627-16717649 AAGGCTGGACAGCCTCGGGGAGG - Intergenic
902694469 1:18130958-18130980 CAGCTCTGACAGCCTCGGGCCGG + Intronic
906107308 1:43302496-43302518 CAGCTTACACTGCCTCAGGTAGG + Intronic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
912557330 1:110525554-110525576 CAGCATGGACAGCCTCTGAAAGG - Intergenic
920039355 1:203085605-203085627 CACCTTGGGCAGCCGCTGGTTGG + Exonic
920204302 1:204280661-204280683 GAGCATGGACAGTCTCGGCTTGG - Intronic
922510138 1:226158809-226158831 AGGCTTGGACAGCCTCCAGTGGG - Intronic
923977523 1:239280638-239280660 CAGCCTGGAAAGTCTCAGGTGGG - Intergenic
924608023 1:245551840-245551862 CAGCCTGGATAACCTGGGGTTGG - Intronic
1066041420 10:31551597-31551619 CAGATTGCCCAGCCTTGGGTAGG - Intergenic
1069888524 10:71638772-71638794 CTGCTGGGACAGACTCAGGTCGG + Intronic
1070948950 10:80415466-80415488 CAGCATGGACAGGCTAGGCTGGG - Intronic
1071470530 10:85981009-85981031 TAGCTTGGACAGCCTCAGCGTGG + Intronic
1076778153 10:132709475-132709497 CAGCCTGCACTGCCTGGGGTGGG - Intronic
1077216454 11:1397169-1397191 CCGCTTGGTCAGCCTAGGCTAGG - Intronic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1080037330 11:27722751-27722773 CAGCTTGCGCAGCCACTGGTGGG - Intergenic
1080105795 11:28510918-28510940 CAAGTTGGACAGGCTGGGGTTGG + Intergenic
1083894384 11:65612894-65612916 CAGCTGGGACCCCCTAGGGTGGG + Intronic
1085035653 11:73298272-73298294 CAGCTGGGCCAGCCTCGTGCTGG + Exonic
1096677086 12:53231853-53231875 CAGCCTGGCCAGCCTCGGGAGGG + Intronic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1099285185 12:80708090-80708112 CACCTTGGGCAGCCTCTGGTTGG - Exonic
1099286340 12:80717404-80717426 CACCTTGGGCAGCCTCTGGTTGG - Exonic
1102042702 12:109810803-109810825 CAGCCTGGACTTCCTGGGGTAGG + Intronic
1105450247 13:20493082-20493104 CATCTTGCACAGACTCGGGTTGG + Intronic
1107906812 13:45068942-45068964 GAGCATGGACAGCCTCTGGGAGG + Intergenic
1110141657 13:72138149-72138171 CAGTTTGAACAGCCTCTGGCAGG - Intergenic
1111672639 13:91348610-91348632 CCGCGTGGGCAGCCTCGGGGCGG + Intergenic
1113897728 13:113776494-113776516 CAGCTCGGACAGCAGCAGGTGGG - Intronic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116096248 14:40373027-40373049 CAGCTTGCTCAGCCTGGGGCTGG + Intergenic
1117826615 14:59710701-59710723 CAGCTTTGGAAGCCTCAGGTCGG + Intronic
1123995694 15:25716417-25716439 CAGATAGGCCAGCCTCAGGTAGG - Intronic
1124602793 15:31148985-31149007 CAGCTTGGAGGGACACGGGTGGG - Intronic
1127315795 15:57792578-57792600 CACCTTGGACAGACCCAGGTGGG + Intergenic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1136604663 16:31325260-31325282 CAGCCTGGACTGCCTCGTGGTGG + Exonic
1138440523 16:57031930-57031952 CAGCTTGGCCAGTCTTGGATGGG + Intronic
1139438234 16:66949021-66949043 CCGGGTAGACAGCCTCGGGTCGG + Intergenic
1140410109 16:74736241-74736263 CAGTATGGACAGCCTTGGGGAGG + Intronic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1141636264 16:85315487-85315509 GAGCCTGGAGGGCCTCGGGTTGG + Intergenic
1142070196 16:88087652-88087674 CAGCCTGCACGGCCTGGGGTGGG - Intronic
1144301386 17:13925312-13925334 CAGATTGGACAGGGTCGGGGTGG - Intergenic
1150571530 17:66391145-66391167 GAGCTTGGAGAGCAGCGGGTGGG + Intronic
1150983427 17:70169267-70169289 CAGCTGGGACAGCAGCAGGTGGG - Intronic
1153163623 18:2237863-2237885 CAGGTTGGAATGCCTCCGGTCGG + Intergenic
1156516940 18:37688117-37688139 CAGCTTGGCGAGCCTCTGCTAGG + Intergenic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1157969355 18:52248487-52248509 CACCTTGGACAGCTTCAGTTAGG - Intergenic
1159334358 18:67044018-67044040 CAGCATGGACAGCTATGGGTAGG - Intergenic
1160392885 18:78548158-78548180 CAGGTCCGTCAGCCTCGGGTGGG + Intergenic
1161164453 19:2778602-2778624 CAGCTTAGACACCCTGGGCTAGG + Intronic
1161332513 19:3695061-3695083 CGGCATGGACAGATTCGGGTGGG + Intronic
1163748202 19:19060382-19060404 ATGTTTGGACAGCCTCAGGTTGG + Intergenic
1164374472 19:27673277-27673299 AACCTTGGACTGCCTGGGGTCGG + Intergenic
1165044340 19:33092801-33092823 CAGCTTGGTCATGCTCGGGGTGG + Intronic
1166410997 19:42555377-42555399 CAGCTTGGACAGGCTGGGTAGGG - Intronic
925313990 2:2907475-2907497 CTGCTTTGACAGCCTCTGGAAGG - Intergenic
925661666 2:6209449-6209471 CAGCTTGGAGAACCTCTGATGGG + Intergenic
926050999 2:9744778-9744800 CAGCTTGCACAGCCTCCTGCCGG - Intergenic
926391150 2:12394238-12394260 CAGCATGGGCAGCTTCTGGTGGG + Intergenic
927163605 2:20294371-20294393 CAGCCTGGACAGCAACAGGTAGG - Exonic
928606576 2:32948708-32948730 CTGCTTGGGCAGCTTTGGGTTGG + Intronic
935437917 2:103056534-103056556 CAAGTTGCACTGCCTCGGGTTGG + Intergenic
935856705 2:107282392-107282414 CAGGTTGGCCAGCCTCTGGTGGG + Intergenic
940109796 2:150138937-150138959 CAGCTGGGAAAGCCTAGGGGAGG + Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
942989606 2:182183563-182183585 AAGCTTTGTCAGCCTAGGGTTGG + Intronic
1171961524 20:31498241-31498263 CTGCTGTGAGAGCCTCGGGTGGG - Intergenic
1172991438 20:39040060-39040082 CAGGTTTCACACCCTCGGGTTGG + Intergenic
1174036925 20:47674235-47674257 CCGCCAGGACAGCCTCGGGACGG - Intronic
1174587554 20:51620804-51620826 GAGCTTGTTCAGCCTCAGGTGGG + Intronic
1174601914 20:51731837-51731859 CAGCTGTGACAGCATGGGGTGGG - Intronic
1175096315 20:56544160-56544182 GCACTTGGACAGCCTCGGGATGG + Intergenic
1176022886 20:62971079-62971101 CAGCACAGACAGCCTCGGGCAGG + Intergenic
1176424518 21:6539916-6539938 CTGCTGGGCCAGCCTCAGGTCGG + Intergenic
1179700011 21:43148231-43148253 CTGCTGGGCCAGCCTCAGGTCGG + Intergenic
1179708173 21:43194404-43194426 CAACTTTGACAGCCCTGGGTAGG - Intergenic
1182619616 22:31611704-31611726 CAGCCTAGACAGCCTGGGGTGGG - Intronic
1184461274 22:44639551-44639573 CAGCTGGGACAGCCCGGGGAAGG + Intergenic
1184902912 22:47458576-47458598 GAGCTTGGACAGCCCTGGGCAGG + Intergenic
1184982953 22:48107144-48107166 AACCATGGACAGCCTCAGGTGGG - Intergenic
950679621 3:14575911-14575933 CAGCCAGGACAGGCTTGGGTAGG + Intergenic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
955008279 3:54990171-54990193 CATCTTGGACAGCACCGGGCTGG + Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
961021970 3:123515483-123515505 CAGCTGGAACAGCCTTGGGTGGG + Intronic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
965820164 3:172676994-172677016 CAGCTTGGGTAGCCTCAGGAAGG - Intronic
968598101 4:1495699-1495721 CAGCTTGGACAGGCGGGGGCAGG + Intergenic
971384724 4:26132529-26132551 CAGCTTCCACAGCCAAGGGTGGG - Intergenic
973570792 4:52237369-52237391 AAGCTTGGAAAGCCTGGGCTGGG + Intergenic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
981104553 4:140865668-140865690 CAGATCTGCCAGCCTCGGGTTGG + Exonic
981423833 4:144581272-144581294 CAGCTTGGCCATCCTCAGGCGGG - Intergenic
991484277 5:67118381-67118403 CAGCTTGGAAAGGCTTCGGTGGG - Intronic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
997642229 5:135456735-135456757 TGGCTAGGACAGCCTCTGGTTGG + Intergenic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
1001020502 5:168178540-168178562 CACCTTGGACAGCCTCTGACAGG - Intronic
1001159411 5:169300559-169300581 CAGCGTGGACTGCCACGGGCTGG - Exonic
1002866284 6:1125090-1125112 CAGCCTGCACTGCCTCTGGTGGG + Intergenic
1004168185 6:13275167-13275189 GAGCTTTGAGAGCCTTGGGTTGG + Intronic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1006375449 6:33669240-33669262 GAGCTCTGACAGCCTCAGGTGGG + Intronic
1007074815 6:39059746-39059768 CAGCTTGGCCAGCGTCTGCTGGG + Intronic
1010151422 6:72737391-72737413 AAGCTTGCACTGCCTCTGGTGGG + Intronic
1013174944 6:107668988-107669010 TAGCTGGCACAGCCTCGTGTTGG + Intergenic
1013863464 6:114663967-114663989 CCGCTTTGAAAGCCTCGGGTGGG - Intergenic
1015496621 6:133889729-133889751 CAGCTTGGAGAGCTTGGTGTCGG - Exonic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1020115768 7:5475564-5475586 CAGCTGAGACAGCCTTGGGCTGG - Intronic
1024109723 7:46133115-46133137 CAGCAGGGACAGCCTAGGGCAGG - Intergenic
1034487633 7:151375968-151375990 CAGCTTGGACAGCCTCGGGTGGG + Intronic
1035316855 7:158001937-158001959 CAGCTTGGCCAGCTTCCGGCTGG - Intronic
1035468667 7:159096174-159096196 GGGCTTGGGCAGCCTTGGGTGGG - Intronic
1037970808 8:23170617-23170639 GCTCTTGGACAGCCTCGGGGTGG + Intergenic
1038613996 8:29076303-29076325 CTGCCAGGACAGCCGCGGGTAGG + Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1042722867 8:71843741-71843763 CAGCTTGGAGAGCTTAGTGTCGG + Exonic
1049426482 8:142540198-142540220 GAGCTGGGACAGCCCCAGGTGGG + Intronic
1056094683 9:83240881-83240903 CAGCTTTGACATCCTCGACTGGG + Intergenic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1059430552 9:114247657-114247679 CAGCTTGGACAGTAGCGGGAAGG + Intronic
1060480532 9:124014511-124014533 CAGCTTGGGCTGCCTAGGTTTGG - Intronic
1060798513 9:126528441-126528463 CAGCTTGGGCAGGCCCGGGCGGG - Intergenic
1061605066 9:131703719-131703741 CTGCTTAGACAGCATCGGTTTGG - Intronic
1062118737 9:134822722-134822744 CAGCTCAGACAGCCGCGGGGGGG - Intronic
1189080338 X:37964357-37964379 CAGCTTGCACAGACTTAGGTAGG + Intronic
1192846025 X:74907918-74907940 CAGCTGAGACAGCCTGAGGTGGG - Intronic
1196245506 X:113394258-113394280 CAGGTTGGAGAGGCTTGGGTTGG + Intergenic
1197415190 X:126165667-126165689 CAGCTCGGGCAGCCTCTGGACGG + Exonic
1197717077 X:129717317-129717339 GAGCTGGGACAGCCTGGGTTGGG + Intergenic