ID: 1034488313

View in Genome Browser
Species Human (GRCh38)
Location 7:151380064-151380086
Sequence ACTTAAGCACACACAGACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 198}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034488313_1034488318 14 Left 1034488313 7:151380064-151380086 CCGAGGTCTGTGTGTGCTTAAGT 0: 1
1: 0
2: 0
3: 20
4: 198
Right 1034488318 7:151380101-151380123 AGTGCATGGTGCCGTTTCTGCGG No data
1034488313_1034488319 15 Left 1034488313 7:151380064-151380086 CCGAGGTCTGTGTGTGCTTAAGT 0: 1
1: 0
2: 0
3: 20
4: 198
Right 1034488319 7:151380102-151380124 GTGCATGGTGCCGTTTCTGCGGG No data
1034488313_1034488315 0 Left 1034488313 7:151380064-151380086 CCGAGGTCTGTGTGTGCTTAAGT 0: 1
1: 0
2: 0
3: 20
4: 198
Right 1034488315 7:151380087-151380109 CTCACCCGGAGAACAGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034488313 Original CRISPR ACTTAAGCACACACAGACCT CGG (reversed) Intronic
900495278 1:2973332-2973354 CCTTAAGCACTCACCCACCTTGG + Intergenic
900730031 1:4251923-4251945 ACTTAAACTCACACAAAACTGGG - Intergenic
903982336 1:27198286-27198308 ACTTAGAAACAGACAGACCTGGG - Intergenic
905244067 1:36600429-36600451 TCTTATGCACACAAAGTCCTAGG - Intergenic
906888445 1:49679362-49679384 ACACAAGCACACACACACCTTGG - Intronic
907545464 1:55256063-55256085 AATGAAGCAAACACAGACATTGG - Intergenic
908053326 1:60256528-60256550 AAGGAAGCACACACAGACCTTGG + Intergenic
911426410 1:97719667-97719689 AGTAAACCACACACTGACCTAGG + Intronic
916325594 1:163556346-163556368 ACTTAACCACACACAGAGCCAGG - Intergenic
917815210 1:178702624-178702646 AGAAAAGCACACACAGATCTTGG + Intergenic
919277829 1:195444408-195444430 ACTTAATCAAACACAAATCTAGG + Intergenic
920976259 1:210788549-210788571 ACTTAAGCAAACACAGAATTAGG + Intronic
922325302 1:224522903-224522925 ACATACGCACACATAGACCTAGG - Intronic
924447781 1:244149904-244149926 ACTTAGACCCAGACAGACCTGGG - Intergenic
1065542091 10:26780699-26780721 ACTAAAGACCACACACACCTGGG + Intronic
1066987261 10:42478859-42478881 AGATGTGCACACACAGACCTGGG + Intergenic
1069726096 10:70580022-70580044 ACTTAAGCACAAAAGGATCTGGG - Intergenic
1071247446 10:83780345-83780367 ACTTAAGGAGACACAGATATTGG - Intergenic
1071549604 10:86556556-86556578 ACTTTAGGAAACACAGACATGGG + Intergenic
1073081869 10:100865517-100865539 ACTTAAGCTCACAGAGGCCCAGG - Intergenic
1075304314 10:121354418-121354440 CCTTTACCACCCACAGACCTGGG + Intergenic
1076087279 10:127645093-127645115 ACTTGAGCACCCACAGACTTTGG + Intergenic
1076195913 10:128518080-128518102 ACTTGTGCACACACACTCCTGGG - Intergenic
1076885970 10:133262574-133262596 GCTTAAACACACACAAAGCTGGG + Exonic
1078889377 11:15540263-15540285 TTTTAAGCAGACACAGGCCTTGG - Intergenic
1079144835 11:17841361-17841383 ACTTATGCACCCAGAAACCTGGG + Intronic
1080987460 11:37486131-37486153 ACTTGAGCACCCACAGATTTGGG - Intergenic
1081657830 11:44868932-44868954 CCTTAAGTACACACAGACCAGGG - Intronic
1083080987 11:60093369-60093391 AATGAAGAACACTCAGACCTGGG - Intronic
1084754171 11:71224280-71224302 TCTTCAGAGCACACAGACCTGGG + Intronic
1085968629 11:81559722-81559744 ACTTAAAAACCCACAGACATAGG + Intergenic
1086287761 11:85269077-85269099 ATTGAAGCACACACATTCCTGGG - Intronic
1088803104 11:113325152-113325174 CCTGCAGCACACACAGCCCTGGG - Intronic
1089218725 11:116852887-116852909 ACTTGAGCAGACAGAGCCCTGGG - Intronic
1089657766 11:119964143-119964165 ACACAAACACACACACACCTTGG + Intergenic
1090996922 11:131875035-131875057 ACTTAAGCTGAGACAGAACTGGG + Intronic
1091042670 11:132296657-132296679 ATATAGGCACACACACACCTGGG - Intronic
1094163775 12:27421077-27421099 ACTTAGGCAAGCACAGAGCTGGG + Intronic
1096114451 12:49047211-49047233 ATTTGAGCACACAGAGACTTAGG + Intronic
1096988205 12:55776119-55776141 ACTTGAGCACCCACAGATTTTGG - Intronic
1101581469 12:106045782-106045804 ATTTAGGCACACTCAGTCCTAGG - Intergenic
1101720431 12:107346030-107346052 ACTTAATGACAAAGAGACCTTGG - Intronic
1101909622 12:108851286-108851308 ACTCAAGCACACAGAAACATCGG + Intronic
1102590995 12:113956760-113956782 ACTTCAGACCCCACAGACCTGGG + Intronic
1105880116 13:24598099-24598121 CTTTAATCACACACAGACATGGG + Intergenic
1105919717 13:24950761-24950783 CTTTAATCACACACAGACATGGG - Intergenic
1106893904 13:34276957-34276979 CCTTAAGCACACAGAGACTCTGG - Intergenic
1107232114 13:38122326-38122348 ACTTGAGCATCCACAGACTTAGG - Intergenic
1107934253 13:45331510-45331532 AGCTAAGCAAACACAGATCTTGG - Intergenic
1109439349 13:62349367-62349389 ACTCAGGCACACAGAGACCCAGG + Intergenic
1110362114 13:74638598-74638620 ATTTAATAGCACACAGACCTTGG + Intergenic
1111179248 13:84640257-84640279 ACTCACACACACACACACCTAGG + Intergenic
1116961594 14:50973204-50973226 TCCCAAGCACACACACACCTGGG - Intergenic
1117439919 14:55749732-55749754 GCTGCAGCCCACACAGACCTGGG + Intergenic
1118303338 14:64633998-64634020 ACTTAAGCACCCACTCATCTGGG - Intergenic
1118708348 14:68500404-68500426 GCTTAAGCACAGGCAAACCTGGG - Intronic
1118737744 14:68714290-68714312 ACTCAAGGTCACACAGATCTAGG - Intronic
1121364756 14:93299077-93299099 ACTAAAATAAACACAGACCTTGG + Intronic
1123874008 15:24605818-24605840 ATTCAAACACACACAGGCCTGGG + Intergenic
1124260020 15:28180927-28180949 ACTTGAGCATCCACAGATCTTGG + Intronic
1125580963 15:40785444-40785466 ACTGAAGCTCACACAGCCTTAGG + Intronic
1126866954 15:52947279-52947301 AATTAAGCACACAAATAGCTTGG - Intergenic
1128618169 15:69126586-69126608 ACTGGCGCACACACAGCCCTGGG + Intergenic
1129002981 15:72349393-72349415 ACTTAGGCACTCACAGACACTGG + Intronic
1130325053 15:82873064-82873086 ACTTAAGGACACACTGGCCATGG + Intronic
1130831475 15:87605542-87605564 ACTTAAACACACACAGTTCTTGG + Intergenic
1131151606 15:90050636-90050658 ACTGAGGCACACACAGACCAAGG + Intronic
1132041467 15:98527995-98528017 ACTTAAGAACACGCAGCTCTGGG - Intergenic
1132126177 15:99227242-99227264 ACCCAAGCAGACTCAGACCTTGG + Intronic
1132534690 16:472282-472304 ACTTCTGCCCACACAGACCCTGG + Intronic
1132544130 16:525348-525370 ACTTGAGCACACAGGGACCCTGG - Intergenic
1132959430 16:2613732-2613754 ACTTAAACTCACTTAGACCTGGG + Intergenic
1132972491 16:2695707-2695729 ACTTAAACTCACTTAGACCTGGG + Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1135761089 16:25138496-25138518 ACATGCGCACACACAGCCCTGGG - Intronic
1136655136 16:31705045-31705067 TCTGAAGCACACACAGGCCTTGG - Intergenic
1136870113 16:33799153-33799175 ACTAAATCACACACTAACCTAGG - Intergenic
1137722830 16:50637876-50637898 CCTTAAACACACCCAGTCCTCGG - Exonic
1137815222 16:51392184-51392206 ATTTAAGCACACAGAGAGTTTGG + Intergenic
1139109564 16:63872950-63872972 AGTTATGCACACACATCCCTTGG + Intergenic
1141076406 16:81009823-81009845 AGGAAGGCACACACAGACCTTGG - Intronic
1141216450 16:82029519-82029541 ACTTACACACACACAGACACAGG + Intergenic
1142273343 16:89102533-89102555 GCAACAGCACACACAGACCTCGG - Intronic
1142417406 16:89949932-89949954 GCTTCTGCTCACACAGACCTGGG - Intronic
1203102058 16_KI270728v1_random:1316901-1316923 ACTAAATCACACACTAACCTAGG + Intergenic
1143982210 17:10879849-10879871 AGTTAAGCAGACACTGAGCTGGG - Intergenic
1146644171 17:34565616-34565638 ACGTAGACACACACAGACCAAGG - Intergenic
1148630704 17:49106171-49106193 GCTCAAGGACACACAGAGCTGGG + Intergenic
1150244951 17:63667607-63667629 ACTTGAGCATCCACAGACCTTGG - Intronic
1150644159 17:66967850-66967872 CCTTAAGCACACAGAGGGCTGGG - Intronic
1152814575 17:82399868-82399890 TCATAAGCACACCCAGACCAGGG + Intronic
1153346540 18:4032388-4032410 CATTAAGCACACAGATACCTTGG + Intronic
1153631634 18:7075995-7076017 ACTTCTGCACACCCAGACATTGG - Intronic
1154144204 18:11853051-11853073 ACCTACACACACACAGTCCTAGG - Exonic
1155843113 18:30670381-30670403 ACTTATCCACACATAGTCCTCGG - Intergenic
1156520571 18:37719481-37719503 ATTTGGGCACACACAAACCTGGG - Intergenic
1156549839 18:38004038-38004060 ACTGTAACACACACACACCTGGG + Intergenic
1157319663 18:46624387-46624409 ACTCAAGCCCACACAGATGTGGG + Intronic
1157788895 18:50512361-50512383 ACATATACACACACACACCTAGG + Intergenic
1158873989 18:61715188-61715210 ACTGAAGCAGACCCAGACTTGGG + Intergenic
1158961489 18:62591332-62591354 TAGAAAGCACACACAGACCTTGG + Intergenic
1166067245 19:40366968-40366990 ACTTAAGCACACACTAAACAGGG + Intronic
1166139354 19:40797759-40797781 ACCAAAACACACACAGACCTCGG - Intronic
1166880335 19:45925728-45925750 ACCAAAGCAAACACAGACCCTGG - Intergenic
1166981324 19:46633969-46633991 ACTGAGGCACGCACAGAGCTTGG - Intergenic
1167586620 19:50378953-50378975 ACTTAGGCTCACAAAGACCTGGG + Intronic
925025986 2:607596-607618 GCTTGAGGAAACACAGACCTTGG - Intergenic
925103936 2:1272980-1273002 CGTATAGCACACACAGACCTAGG - Intronic
926005607 2:9371457-9371479 ATTTAAGCAGGCACAGAGCTGGG - Intronic
928852413 2:35766143-35766165 ACTTGAGCATCCACAGACTTTGG + Intergenic
931194770 2:60041065-60041087 ACTTTAGATCAGACAGACCTGGG - Intergenic
931217906 2:60263553-60263575 TCTTAAGAACACGCACACCTGGG - Intergenic
932011716 2:67984485-67984507 ACTAAAGCAAACAGAGAGCTGGG - Intergenic
933306560 2:80607424-80607446 CATCAAGCACACACAGAGCTTGG - Intronic
933996305 2:87672484-87672506 ACTTGAGCACACATGTACCTCGG + Intergenic
936297550 2:111278427-111278449 ACTTGAGCACACATGTACCTCGG - Intergenic
938049414 2:128154093-128154115 ACATAAGCACACACACACTGAGG + Intronic
939884620 2:147667736-147667758 AATTAAGCATTCACAGACATTGG + Intergenic
940087522 2:149877409-149877431 ACTTCAGCATACACAGTTCTGGG - Intergenic
940324441 2:152410677-152410699 AGCCAAGCACAGACAGACCTTGG - Intronic
946241125 2:218356775-218356797 ACTTTACTACACCCAGACCTTGG - Intergenic
948119119 2:235515810-235515832 AATTAAACACGCACAGAGCTGGG + Intronic
948818358 2:240525482-240525504 AGTAAAGAACACACATACCTTGG + Intronic
1169204386 20:3732092-3732114 ACTTGAGCAAAGACAGAGCTAGG + Intergenic
1169295625 20:4395127-4395149 ACTTATGATCACACAGGCCTGGG - Intergenic
1171945929 20:31377631-31377653 ACATATACACACACAGACCCAGG - Intronic
1175594210 20:60217542-60217564 ACTTGAGCATCCACAGACTTCGG - Intergenic
1176228989 20:64021228-64021250 ACACACGCACACACAGACATGGG - Intronic
1176229024 20:64021604-64021626 ACACACGCACACACAGACATGGG - Intronic
1180118327 21:45726484-45726506 CCTTGAGCACACAGAGATCTGGG - Intronic
1180245424 21:46544214-46544236 ACTTAAGTAAAAACAGAACTGGG + Intronic
1180519429 22:16183457-16183479 ACTTAAGTACAGAAAAACCTAGG + Intergenic
1184521463 22:44996812-44996834 ACATAAGCATACACAGAGGTGGG + Intronic
951292413 3:20889354-20889376 ACTTGAGCATACACAGATGTTGG - Intergenic
953891139 3:46752484-46752506 ACTGAAGCCCACCCATACCTGGG + Intronic
955882051 3:63557236-63557258 ACATAAACACACATACACCTAGG + Intronic
956757066 3:72399091-72399113 ACTTGAGCACCCACAGATTTTGG - Intronic
957389798 3:79549689-79549711 ACTTGAGCATCCACAGATCTTGG + Intronic
961156777 3:124686385-124686407 ACCTAAGAATACACAGTCCTGGG - Intronic
961504336 3:127360346-127360368 GCTAAAGCACTCTCAGACCTTGG - Intergenic
963544214 3:146634438-146634460 TCTTCAGTTCACACAGACCTAGG + Intergenic
966212256 3:177465522-177465544 ACTTAAGGTCACACAGCTCTAGG + Intergenic
966490336 3:180520870-180520892 ACATAAACACACAAATACCTAGG + Intergenic
967738962 3:192984181-192984203 ACTGAAGAAGATACAGACCTTGG + Intergenic
968284038 3:197497819-197497841 ACCTAAGCAGACACATTCCTGGG + Intergenic
968750251 4:2385200-2385222 GCTTCAGGACAGACAGACCTGGG + Intronic
969155562 4:5206704-5206726 ACTTCAGCAGAAACAGATCTGGG - Intronic
970041248 4:11799388-11799410 CCTTTAGCAAACACAGATCTCGG - Intergenic
971005022 4:22363864-22363886 ACCTAAGCACTAAAAGACCTTGG + Intronic
972414082 4:38821582-38821604 ACTTGAGCATTCACAGACTTTGG + Intronic
972655010 4:41055723-41055745 ACTTAAGCCTACACAGACAATGG - Intronic
974889150 4:67858186-67858208 ACTTACGCAGACAAATACCTTGG + Intronic
975755198 4:77564926-77564948 ACATAAACATCCACAGACCTTGG + Intronic
975820346 4:78264830-78264852 TCTTAAGGGCACACTGACCTTGG + Intronic
976837879 4:89396440-89396462 CCTGAAGCTCACACAGAGCTGGG - Intergenic
977196029 4:94061185-94061207 ACTTCAGGATACACAGAACTAGG + Intergenic
977366328 4:96073104-96073126 ACTTGAGCACCCACAGATTTTGG + Intergenic
977389525 4:96390236-96390258 AAGTAAGCAAACACATACCTGGG + Intergenic
978690856 4:111507569-111507591 ACATTAGTACACACAGACCTGGG + Intergenic
983545929 4:168964253-168964275 ACATATGCATACTCAGACCTTGG - Intronic
986007760 5:3682434-3682456 ACTTAAGCATACATAGATTTTGG - Intergenic
987533184 5:19148327-19148349 ACATACACACACACACACCTGGG - Intergenic
987879118 5:23718432-23718454 ACATAAGCAAACACTGAACTTGG + Intergenic
988539373 5:32095518-32095540 ACTTCAACACACCCAAACCTTGG + Intronic
989307085 5:39970683-39970705 AATTAAACACACACACAACTAGG + Intergenic
990608330 5:57432327-57432349 ACTCAATCACCCACAGACCGAGG + Intergenic
991607317 5:68416027-68416049 ACACAGGCACACACAGTCCTTGG - Intergenic
993904606 5:93608978-93609000 AATTAACAACACACAGAGCTCGG + Intergenic
996591700 5:125155291-125155313 ACTAATACACACACAGAGCTAGG - Intergenic
997881972 5:137599749-137599771 ACCTGAGCACACACAGCTCTGGG + Intergenic
999693024 5:154165324-154165346 ATTTTAGGTCACACAGACCTGGG + Intronic
1000824456 5:166027511-166027533 ATTTAGGCACAGACAAACCTGGG + Intergenic
1005917278 6:30364261-30364283 ACTTCAGCAAACGCAGACCCTGG - Intergenic
1008318947 6:50082926-50082948 ACTGAAGCACAAAGAGGCCTGGG - Intergenic
1009548361 6:65052236-65052258 ACATAAAAACACACACACCTGGG - Intronic
1012467174 6:99529151-99529173 ACTTGAGCATCCACAGACTTTGG + Intergenic
1013626802 6:111945918-111945940 ACTTGAGCACAGCCAGACTTTGG - Intergenic
1014972688 6:127837067-127837089 TCTTAATCAAACACAAACCTTGG - Intronic
1015275704 6:131381487-131381509 ACTCACGCACACACTGACTTAGG - Intergenic
1019179616 6:170178107-170178129 CTTTGAGCACAGACAGACCTGGG - Intergenic
1020512717 7:9079054-9079076 ACTTAAACACAGACAAACTTGGG - Intergenic
1022129057 7:27387083-27387105 ACAAAAGCACACAAAGCCCTTGG - Intergenic
1023348633 7:39297032-39297054 TCATAGGCACAAACAGACCTAGG - Intronic
1023558880 7:41451511-41451533 CCTGAGGCACACACAGAGCTTGG - Intergenic
1023578086 7:41651340-41651362 ACATATACACACACACACCTTGG - Intergenic
1026571033 7:71530902-71530924 TCTTAAGCACACAATGATCTAGG + Intronic
1031528041 7:122845236-122845258 ATCTTAGCACACACAAACCTGGG - Intronic
1033868049 7:145716418-145716440 ACATGAGAACACACAGACATAGG - Intergenic
1034488313 7:151380064-151380086 ACTTAAGCACACACAGACCTCGG - Intronic
1035064848 7:156097021-156097043 ACTGAAGCAAACACGGACCTGGG + Intergenic
1035631656 8:1111292-1111314 CCTTCAGCACACACAGTGCTGGG - Intergenic
1038275943 8:26120682-26120704 ACTTCAGCAGACACAGCCCGAGG - Intergenic
1039286102 8:36042456-36042478 ACTGAAGCTCAAAAAGACCTTGG + Intergenic
1039440607 8:37592713-37592735 ACTTATGGACACATAGATCTGGG + Intergenic
1044027060 8:87185647-87185669 TCTGGAGCTCACACAGACCTGGG - Intronic
1044478757 8:92660071-92660093 ATTTTAGCACAGCCAGACCTGGG + Intergenic
1047454085 8:124993134-124993156 AATTCAGGACACCCAGACCTGGG - Intergenic
1047511478 8:125519340-125519362 ACATACACACACACACACCTTGG + Intergenic
1047755324 8:127913739-127913761 ACTTAATCCCACACAGACCCTGG - Intergenic
1048484616 8:134835195-134835217 ACTTAAACACACACACACAGTGG - Intergenic
1050648231 9:7745548-7745570 ACACAAACACACACAAACCTAGG - Intergenic
1053453921 9:38216277-38216299 ACTTAAAAACACAAAGACATAGG + Intergenic
1055127642 9:72737498-72737520 ACTCAGACTCACACAGACCTAGG - Intronic
1059005729 9:110399990-110400012 ACTAAAGTAAACAGAGACCTAGG + Intronic
1059399369 9:114059279-114059301 ACTTCAGAACACACAAAGCTGGG + Intergenic
1060483997 9:124035653-124035675 ACTAAGACACACACAGACTTGGG + Intergenic
1060897748 9:127229117-127229139 ACTTAAGCATAAACAGAGCCAGG - Intronic
1060972021 9:127743763-127743785 ACTGAAGCACAGAGAGAACTGGG + Intronic
1061442714 9:130617420-130617442 ACTTCAGCACATACGGCCCTAGG - Intronic
1186223720 X:7375617-7375639 CCTCAAGCACACACACACCCAGG + Intergenic
1186368481 X:8921387-8921409 ACTTAAGCATCCACAGACTTTGG + Intergenic
1187179366 X:16929206-16929228 AAATAATCACACACTGACCTTGG - Intergenic
1193246942 X:79239936-79239958 AGTTAAGCACACACAGTACTTGG - Intergenic
1196176178 X:112641412-112641434 TCCTGAGCACACACAGACCTGGG - Intronic
1197666357 X:129228312-129228334 ACTTAAGCATCCACAGATTTTGG + Intergenic
1197821707 X:130547806-130547828 ACTTAACCACACTCAGCCCAAGG - Intergenic
1199110847 X:143932082-143932104 ACTTAAGCACCCATTGACCAAGG - Intergenic
1199357550 X:146879474-146879496 ACTTGAGCATCCACAGATCTTGG + Intergenic
1201458007 Y:14192149-14192171 ACTCATGCACACACAAACCTAGG - Intergenic