ID: 1034491048

View in Genome Browser
Species Human (GRCh38)
Location 7:151393285-151393307
Sequence CTGTGTGCACACACAGGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 380}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034491048_1034491055 -9 Left 1034491048 7:151393285-151393307 CCTATGCCTGTGTGTGCACACAG 0: 1
1: 0
2: 2
3: 38
4: 380
Right 1034491055 7:151393299-151393321 TGCACACAGGTGTGTGGGGTGGG No data
1034491048_1034491054 -10 Left 1034491048 7:151393285-151393307 CCTATGCCTGTGTGTGCACACAG 0: 1
1: 0
2: 2
3: 38
4: 380
Right 1034491054 7:151393298-151393320 GTGCACACAGGTGTGTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034491048 Original CRISPR CTGTGTGCACACACAGGCAT AGG (reversed) Intronic
900555912 1:3280407-3280429 CTGTTTGCACACAGAGGAAGTGG + Intronic
900562248 1:3313040-3313062 TGGTGTACACACACAGGCACAGG + Intronic
901041732 1:6368295-6368317 CTTTGGGCACCAACAGGCATGGG - Intronic
901122928 1:6909770-6909792 CTGTGTGCACAAAAAGACTTGGG + Intronic
901196626 1:7443891-7443913 CTGTGTCCAGGCAGAGGCATGGG - Intronic
901627234 1:10631222-10631244 CTGTGTGGACACAAGGGCTTCGG + Intergenic
901760948 1:11471136-11471158 ATGTGTGTACACACAGCCAGGGG - Intergenic
902169294 1:14598080-14598102 CTGGATGCACACACAGGGCTAGG + Intergenic
902516187 1:16990862-16990884 ATATGTGCACACACATTCATGGG - Intronic
902957284 1:19934215-19934237 CTGTGGGCACCCAAAGGCCTGGG + Intergenic
903540145 1:24092247-24092269 CTCTGTTCACATCCAGGCATCGG + Exonic
907886887 1:58600166-58600188 CTATGAGGACACAAAGGCATAGG - Intergenic
908678370 1:66631487-66631509 CTGTGTCCACACAGATGCAGAGG - Intronic
909128669 1:71707634-71707656 CTGTGTTCACTCACAGCCCTGGG - Intronic
909205375 1:72750171-72750193 GTGTGTGCACAAACACACATAGG + Intergenic
909740949 1:79029201-79029223 TTTTGAGCAGACACAGGCATTGG - Intergenic
909924633 1:81425259-81425281 CTGTGTGTGTACACATGCATGGG - Intronic
912519861 1:110237925-110237947 GTGTATGCACACACAGGGCTTGG - Intronic
912542357 1:110426650-110426672 CTGTGTGCACACACACACACAGG + Intergenic
913236691 1:116791135-116791157 CTGTGAGGACACAAAGGCACAGG + Intergenic
916207838 1:162332456-162332478 CAGTGTGCACTCAGTGGCATTGG + Intronic
916489474 1:165288722-165288744 CTGTGCTCACACACAGGCTCAGG + Intronic
917137173 1:171798930-171798952 GTGTGTGTACAGACAGCCATTGG + Intronic
917476898 1:175376530-175376552 CTGTGTCTGAACACAGGCATTGG + Intronic
918803720 1:189009973-189009995 GTGTGTGTACACACAAGAATAGG + Intergenic
918916713 1:190650003-190650025 CAGTGTTAACACACAGCCATTGG + Intergenic
919399353 1:197091240-197091262 GTGTGTGCACACACATGCACAGG + Intronic
920532385 1:206713221-206713243 CTGTGGGCACAGAGAGGCAGAGG + Intronic
920657680 1:207888531-207888553 ATGTGTGCACACACAGTAATCGG - Intronic
921189399 1:212696442-212696464 GTGTGTGTACACACACACATTGG + Intronic
921553463 1:216568099-216568121 CTGTGAGCAAAGACAGGCACCGG + Intronic
922451102 1:225737970-225737992 CTCTGAGAACACACAGGCCTGGG - Intergenic
923050825 1:230390287-230390309 CTGTGTAGACCCAAAGGCATGGG - Intronic
923057900 1:230441703-230441725 GTGTTTGCAAACACAGGCACTGG - Intergenic
923425471 1:233864594-233864616 CTGGGTACACACCCAGTCATAGG - Intergenic
923784184 1:237051771-237051793 GTGTTTGCAGACACAGGCAGTGG + Intronic
924038954 1:239964511-239964533 CTCTGTGCACACACAAACACAGG - Intergenic
924739764 1:246788209-246788231 CTGTGTGCACCCACAGGCCAGGG - Intergenic
1063602770 10:7497217-7497239 CTGTCTGCACTCTCAGGCCTGGG + Intergenic
1066490580 10:35890173-35890195 CTGTTTGCAGACACAGGAAGAGG - Intergenic
1066567839 10:36738871-36738893 CTGTATGCACACATATGCAGGGG - Intergenic
1067074205 10:43164434-43164456 GTGTGTGTGCACACATGCATGGG - Intronic
1067512499 10:46907602-46907624 GTGTGTGCACGCAGAGCCATGGG + Intergenic
1067649745 10:48144220-48144242 GTGTGTGCACGCAGAGCCATGGG - Intergenic
1067714936 10:48683599-48683621 CTCTGGGCATTCACAGGCATGGG + Intergenic
1068954295 10:62807464-62807486 CTGTGTGCATAAAGAGGCAAAGG - Exonic
1069873712 10:71548628-71548650 CTGTGTACACACAGAGACAGAGG + Intronic
1070565929 10:77603818-77603840 CTAAGTGCAGACACTGGCATTGG + Intronic
1072080855 10:92030059-92030081 CTGTGTGCATACATATGTATGGG + Exonic
1072784801 10:98272398-98272420 CTGGGTGCACACTCTGGCACAGG + Intergenic
1074872065 10:117584900-117584922 CAGTGAGAACACACAGACATAGG - Intergenic
1075179293 10:120195889-120195911 ATGTGTGCACACACAATCAGGGG - Intergenic
1075914472 10:126155594-126155616 CTGGGTGCACACACTTGCAAAGG + Intronic
1076165794 10:128281406-128281428 ATGTGTGCACACACACATATGGG - Intergenic
1076534316 10:131167166-131167188 CTGCCTGCACACACAGGCACAGG - Intronic
1077052113 11:571614-571636 CCGTGTGCACATACAGGGCTTGG - Intergenic
1078034748 11:7791555-7791577 CTGTGTACACACACACACAATGG + Intergenic
1078882790 11:15468906-15468928 ATGAGTGCCCACACAGCCATTGG + Intergenic
1078927840 11:15890414-15890436 CTCTGTGCACACTCAGCCAATGG + Intergenic
1079615097 11:22482279-22482301 CTGTTTGCAAACAAAGGCACTGG - Intergenic
1081239867 11:40691929-40691951 CTGTCTCCACAGACAGGCAGGGG + Intronic
1081962424 11:47148249-47148271 CTGTGAGCCCAAACAGACATGGG + Intronic
1083398494 11:62407674-62407696 ATCTGTTTACACACAGGCATGGG - Intronic
1083953915 11:65972024-65972046 CTCTGTCCACATACAGTCATTGG + Intronic
1084087745 11:66862321-66862343 CTGGCCACACACACAGGCATAGG + Intronic
1084116278 11:67044780-67044802 CTGTGGGCACCCGGAGGCATCGG + Intronic
1084401639 11:68947304-68947326 CTGCCTGCAAACACAGGCAGAGG + Intergenic
1084722447 11:70915944-70915966 CTGTCAGCAGACACAGACATGGG + Intronic
1085100524 11:73796468-73796490 CTTTGGGCACCAACAGGCATAGG + Intronic
1085273022 11:75281472-75281494 CTGTGTGCACACCCGGCCCTGGG + Intronic
1085741660 11:79082589-79082611 ATGTGTGCACACACACACACAGG + Intronic
1087355780 11:97092421-97092443 CTCTGTGCACACTCAGACAAGGG - Intergenic
1088754142 11:112872013-112872035 CTCTGTGCCCACACGGGCAGGGG + Intergenic
1089623782 11:119738359-119738381 GTGTGTGCATTCACATGCATAGG - Intergenic
1090662310 11:128891061-128891083 CGGCGCTCACACACAGGCATGGG + Intergenic
1091151699 11:133335058-133335080 CTGTGGCTAAACACAGGCATGGG - Intronic
1091218356 11:133917186-133917208 GCCTGGGCACACACAGGCATCGG - Intronic
1091587138 12:1822785-1822807 CTGGGTGCCCAGACAGGCAGCGG + Intronic
1091850479 12:3693122-3693144 CTGCCTGCACACACATGCACCGG + Intronic
1094008735 12:25784174-25784196 CTCTCACCACACACAGGCATGGG + Intergenic
1094520927 12:31187860-31187882 ATGTGTGCACACACACACACAGG - Intergenic
1095176808 12:39101941-39101963 CTATGCGGACACAAAGGCATAGG + Intergenic
1097001716 12:55882589-55882611 CTCAGGGCACACACAGTCATGGG - Intergenic
1097603543 12:61724580-61724602 CTGTGCAGACACAAAGGCATAGG - Intronic
1097721348 12:63024925-63024947 ATGTGTGTACATACATGCATGGG + Intergenic
1097885166 12:64721640-64721662 CATTGTCCTCACACAGGCATAGG + Exonic
1098519044 12:71414755-71414777 CTGTGAGGACACAAAGGCATAGG + Intronic
1098796121 12:74890008-74890030 GTGTGTGCACACACACACAGAGG + Intergenic
1099963942 12:89424969-89424991 ACGTGTGCACACAAATGCATAGG + Intronic
1100854397 12:98746065-98746087 CTGTGTGCTCACAAGGGCAAGGG - Intronic
1101777750 12:107809051-107809073 CGGTGTGATCACTCAGGCATGGG - Intergenic
1102207496 12:111100375-111100397 ATGAGTGCACACACAGAGATAGG - Intronic
1102579265 12:113875855-113875877 CTCTGTGCACACACAGGAGAGGG + Intronic
1104919689 12:132284184-132284206 ACGTGTGCACACACATGCGTGGG - Intronic
1105561454 13:21496296-21496318 CTGTGTGCACACAGAGAGAAAGG - Intronic
1106462181 13:29980869-29980891 TTATGAGCAGACACAGGCATTGG + Intergenic
1106571142 13:30929191-30929213 CTGTGTGCTCACACAAGCCCAGG + Intergenic
1106876836 13:34083547-34083569 CTATGTGCACACAAAGCCACTGG - Intergenic
1108166015 13:47693901-47693923 GTGCGTGCACACACATGCACAGG - Intergenic
1108253726 13:48591128-48591150 AGGTGTGCACACACACTCATAGG - Intergenic
1111358753 13:87146142-87146164 CTGTGTGCAGCCTCAGGAATTGG + Intergenic
1113088951 13:106597337-106597359 CTGTGTGGCCACAGAGGCAGAGG + Intergenic
1113448972 13:110392514-110392536 CTGAGTGGACACACAGGCAGAGG - Intronic
1113947897 13:114054921-114054943 CTGTGGGCACACACACCCCTGGG - Intronic
1113947910 13:114054999-114055021 CTGTGGGCACACGCACCCATGGG - Intronic
1114006121 14:18314974-18314996 CTGTATGCACACATATGCAGGGG - Intergenic
1114077056 14:19166862-19166884 CTATGTGGACACACAGGCCCTGG + Intergenic
1114085101 14:19232702-19232724 CTATGTGGACACACAGGCCCTGG - Intergenic
1114622259 14:24103277-24103299 CTGTGTGCACACACAGGAGAGGG - Intronic
1117734814 14:58757748-58757770 CTGTGTGCATTTACAGGCATTGG + Intergenic
1118200147 14:63663837-63663859 CTTTGGGCACAAACAAGCATGGG - Intergenic
1118822211 14:69352902-69352924 ATGTGGGCACCCACAGGCACAGG - Intronic
1119180099 14:72599844-72599866 CTGTGGGCTCACACAGGCCTCGG + Intergenic
1120144597 14:80966102-80966124 TTATGAGAACACACAGGCATGGG - Intronic
1121114411 14:91333545-91333567 CTGTGTGCACACACAGGACACGG + Intronic
1121248574 14:92482872-92482894 CTGTGTGCACAGCCAGGGAGAGG + Intronic
1121520290 14:94581463-94581485 CTGTGTGCACACTCAGCTACGGG + Exonic
1121869305 14:97392626-97392648 GTGTGTGTGCACACATGCATGGG - Intergenic
1122043614 14:99007926-99007948 GTGTGTGCACGCACATGCAATGG - Intergenic
1122133324 14:99618741-99618763 CTCTGTGCCCACACCGGCCTAGG - Intergenic
1122953013 14:105056290-105056312 GTGAGTGCAAACACAGGCGTTGG - Intronic
1123007874 14:105333146-105333168 GTGTGTGCACACGCGTGCATGGG - Intronic
1202896677 14_GL000194v1_random:14410-14432 CTATGTGGACACACAGGCCCCGG - Intergenic
1123475545 15:20590244-20590266 CTGTATACACATACAGACATGGG - Intergenic
1123642466 15:22410119-22410141 CTGTATACACATACAGACATGGG + Intergenic
1124690925 15:31822268-31822290 ATGTAGGCAGACACAGGCATGGG + Intronic
1125588423 15:40838825-40838847 CAGCATGCACACACAGGAATGGG + Intergenic
1126355503 15:47791039-47791061 ATAAGTGCACACATAGGCATGGG + Intergenic
1127005642 15:54566491-54566513 CTCTGTGAAAACACAGGCTTTGG - Intronic
1127828170 15:62724616-62724638 ATGTGTGTACACAGAGTCATGGG - Intronic
1128302319 15:66574331-66574353 CTTGGTGCAGACACTGGCATTGG + Intergenic
1128373580 15:67059295-67059317 CTGTGTGCAGACCGAGGCATGGG - Intergenic
1129726550 15:77904440-77904462 CTCTCTGCAAACACAGGCCTGGG + Intergenic
1130550399 15:84886869-84886891 GTGTGTGCACGCACATGCACGGG + Intronic
1130738228 15:86571984-86572006 CTTTGTGCACCAACAAGCATGGG - Intronic
1130861109 15:87890684-87890706 ATGTGAGAAGACACAGGCATAGG - Intronic
1131346147 15:91650321-91650343 GTGTGTGCACACATGTGCATGGG - Intergenic
1131771121 15:95738139-95738161 CTGTGCAAACACACAGCCATGGG + Intergenic
1131847173 15:96500457-96500479 CTGTGTGCACACGGAGGCCTCGG + Intergenic
1132076098 15:98821859-98821881 ATGTGTGCACACACACACACAGG + Intronic
1132396892 15:101481017-101481039 CTGTGTGCTCTCACTGGCCTGGG - Intronic
1132602717 16:781206-781228 CTGTGAGAACACAGAGCCATGGG - Intronic
1132689523 16:1176353-1176375 CTGTGAGGACAGCCAGGCATGGG + Intronic
1133285896 16:4690673-4690695 CCGAGTGCACACACATGCATGGG - Exonic
1133391749 16:5415933-5415955 CTGAGTCCACACACATGCAGAGG - Intergenic
1133511080 16:6457971-6457993 GCGTGTGCACACACATACATAGG + Intronic
1133734182 16:8601597-8601619 CTATGTGAACACCCTGGCATGGG - Intergenic
1134392141 16:13829928-13829950 ATCTGTAGACACACAGGCATTGG - Intergenic
1137751001 16:50861053-50861075 ATGTGTACACACACACACATAGG + Intergenic
1137892216 16:52174624-52174646 TTGGGTGCACACCCAGGCAGCGG - Intergenic
1141141381 16:81498816-81498838 CTGTGTGCACACGCAGGGGCAGG - Intronic
1141432681 16:83978895-83978917 CTGGGAGGACACACAGGCATTGG - Intronic
1141675442 16:85515066-85515088 ACGTGTGCACACACATCCATAGG - Intergenic
1142432280 16:90036066-90036088 CTGGGTGGCCACACAGGCCTCGG + Intronic
1143099631 17:4498290-4498312 CCGGGTGCCCACACAGGAATGGG + Intergenic
1145714849 17:27009815-27009837 ATGTGTGCACAGACATACATGGG - Intergenic
1146127657 17:30241386-30241408 CTGTGCGCCCACACAGTGATAGG - Intergenic
1147947271 17:44087093-44087115 GTGTGTGTACACACACGCACAGG + Intronic
1149362546 17:55910738-55910760 CTTTGTGCACCAACAAGCATGGG - Intergenic
1149654768 17:58304499-58304521 ATGTGTGAACACAAAGGCCTTGG - Intronic
1151086650 17:71388177-71388199 CTGTGTGCAGACTCAGGACTTGG - Intergenic
1151943414 17:77306495-77306517 CTCTGCCCACACACAGGCCTTGG - Intronic
1153610313 18:6878000-6878022 CTGTGTACACATGCATGCATGGG + Intronic
1154531355 18:15349207-15349229 CTGTATGCACACATATGCAGGGG + Intergenic
1155038041 18:22041868-22041890 GTGTGTGTACACACGTGCATGGG + Intergenic
1155820309 18:30366914-30366936 TTGTGTGTACACACAGACACAGG - Intergenic
1156089270 18:33445326-33445348 GTGTGTGCACACATGTGCATGGG + Intergenic
1156372360 18:36483000-36483022 TTCTGAGCCCACACAGGCATGGG - Intronic
1156917939 18:42483795-42483817 ATGTTTGCAAGCACAGGCATGGG + Intergenic
1157620784 18:49016558-49016580 CTGTGTCCACTCACAGGCCAGGG - Intergenic
1160457112 18:79009117-79009139 CAGTGTGCAGACACAGGCCAGGG - Intergenic
1160795509 19:943624-943646 CTGTGTGGAGACAGAGGCAGAGG + Intronic
1161778650 19:6277757-6277779 CGCTGGGCACACAGAGGCATAGG - Intronic
1163014210 19:14443843-14443865 GTGTGTGCACATACAGGTGTGGG - Intronic
1163233500 19:16018719-16018741 CTGTGGGGGCACAAAGGCATGGG - Intergenic
1163502550 19:17685741-17685763 CTGTGTGGACACAAATGCTTAGG - Intronic
1164571428 19:29377434-29377456 CTATGTACAAACACAGGCAGTGG + Intergenic
1165340981 19:35212027-35212049 CCGTGGGCACACCCAGGCAGAGG + Intergenic
1165467290 19:35982555-35982577 CTGGGTTCACACACAGGCTGTGG - Intergenic
1166267100 19:41691023-41691045 CTTTGTGGACACAGAGGCACTGG - Intronic
1166985853 19:46659746-46659768 CTCTGGCCACACACAGGCTTGGG + Intronic
1167380750 19:49136702-49136724 CTCTGTCCCCACACAGGGATAGG + Exonic
1167885672 19:52498014-52498036 CCATGTGCACACACAGCAATAGG - Intronic
1168097037 19:54121837-54121859 CTGTGAGGACACGGAGGCATGGG - Intronic
1168249012 19:55130488-55130510 CTGTGTCCTCACACAGCCAAAGG + Intergenic
1168269455 19:55241682-55241704 CTGTGCGCCCACACAGGAGTAGG + Intronic
1168544001 19:57235115-57235137 CTGTGGGCACACACACACACAGG + Intronic
925067386 2:938988-939010 CCATGTGCACACGCATGCATGGG + Intergenic
925160520 2:1680630-1680652 GCTTGTGCACACCCAGGCATCGG + Intronic
925235088 2:2271052-2271074 ATGTGTACACACACAGACACGGG - Intronic
925658726 2:6179980-6180002 ATGCATGCACACACATGCATGGG + Intergenic
927389790 2:22582330-22582352 CTGTGTGCAGACACAGGACTTGG + Intergenic
928360114 2:30655871-30655893 CTGTGTGCAGACCCAGGCAAAGG + Intergenic
930752473 2:54946325-54946347 CTGTGGGCACAACCCGGCATTGG - Intronic
932221888 2:70006110-70006132 GTGTGTGCGCACATGGGCATGGG - Intergenic
932574041 2:72953105-72953127 CTGTGTGCACGCGCAGGTTTGGG + Intronic
933166818 2:79085666-79085688 CTGTGTGCACACTCAGAAACAGG + Intronic
934704709 2:96468908-96468930 GTGTGTACACAGACATGCATAGG + Intergenic
936247158 2:110838364-110838386 GTGTGCGCACACACAGGCAGTGG + Intronic
936607745 2:113974996-113975018 TTGTGTGCACACACAGGGTCCGG - Intergenic
936765181 2:115838776-115838798 GTGTGAGCACACACACACATAGG + Intronic
936768247 2:115879505-115879527 CTCTGTGCACACAAAGGAAAGGG + Intergenic
936996636 2:118421677-118421699 CTGTGTGCACATACAGGCTTGGG - Intergenic
937711126 2:124981302-124981324 ACGTGTGCACACACAAACATGGG - Intergenic
937781431 2:125843171-125843193 CCTGGTGCTCACACAGGCATGGG - Intergenic
938083866 2:128385470-128385492 GTGTGTGCACACACAGGTCGGGG + Intergenic
938530453 2:132180487-132180509 CTGTATGCACACATATGCAGGGG + Intronic
938624731 2:133095916-133095938 CCGTGTGTACAAAGAGGCATGGG - Intronic
939233917 2:139466979-139467001 CTGTTTCCACTCACAAGCATAGG - Intergenic
939637815 2:144604123-144604145 ATGTGTGCATAAACATGCATGGG - Intergenic
939639110 2:144617938-144617960 CTATGAGGACACAAAGGCATAGG - Intergenic
943819219 2:192298780-192298802 CTGGGTGGACACATATGCATAGG + Intergenic
944861720 2:203821628-203821650 CTGTGTGTACCCATTGGCATTGG + Intergenic
947512977 2:230775803-230775825 CTGTGTGGGCAGATAGGCATAGG + Intronic
947552040 2:231053185-231053207 CTGTGGCCTCACACAGGTATCGG - Intergenic
948082876 2:235220728-235220750 CTGTCTCCACACAGATGCATTGG + Intergenic
948227595 2:236323533-236323555 CTGTGTACAGACACAGGCTGGGG + Intergenic
1169362711 20:4964640-4964662 ATGTGTGCACACACTGAAATGGG - Intronic
1172602706 20:36194934-36194956 GTGTGTGCACACACAGGCCAGGG + Intronic
1172899572 20:38324667-38324689 CTGACTGCACACACAGACAGTGG - Intronic
1173823744 20:46034452-46034474 CCGTGTGCCAATACAGGCATGGG - Intronic
1174752567 20:53126258-53126280 CTGTGTGATCGCACAGGCATAGG - Intronic
1175173359 20:57094588-57094610 CTGTGTGCCCACAGAGGCGGAGG - Intergenic
1176192303 20:63817780-63817802 CTGTGTGAAGACAGAGGCAGAGG + Intronic
1176616365 21:9030406-9030428 CTATGTGGACACACAGGCCCCGG - Intergenic
1176708763 21:10133223-10133245 CTATGTGGACACACAGGCCCCGG + Intergenic
1176766001 21:13018944-13018966 CTGTATGCACACATATGCAGGGG - Intergenic
1177461124 21:21412226-21412248 CTGTGTGCGCACAGAGGAAAGGG - Intronic
1177606004 21:23378795-23378817 CTGTGTGCAGCCACAGGACTTGG + Intergenic
1179116200 21:38494817-38494839 GTGCATGCACACACAGGCAGAGG + Intronic
1179187137 21:39093710-39093732 CTGAACGCACACACAGGCCTGGG + Intergenic
1180032792 21:45223803-45223825 CTGTGTGGACACACGTGGATGGG - Exonic
1180055024 21:45353175-45353197 GTATGTGCACACACATGCACAGG + Intergenic
1180080385 21:45484251-45484273 ATATGTGCACACACACACATAGG + Intronic
1180292869 22:10860491-10860513 CTATGTGGACACACAGGCCCTGG + Intergenic
1180430631 22:15245781-15245803 CTGTATGCACACATATGCAGGGG - Intergenic
1180495676 22:15889913-15889935 CTATGTGGACACACAGGCCCTGG + Intergenic
1180695938 22:17751672-17751694 CTGGGGGCTCACACAGGCCTGGG + Intronic
1180726402 22:17949833-17949855 CTGTGTGCACACAAAGCAACTGG + Intronic
1180937332 22:19634397-19634419 CTGCGTGCACCCTCAGGCAGTGG + Intergenic
1181989075 22:26822812-26822834 CAGGGTGCACACACAGGGTTGGG + Intergenic
1182051007 22:27312779-27312801 ATGTGTACACACACATGCATAGG + Intergenic
1182282300 22:29224667-29224689 CACTGTGCACACACAGGGACTGG - Intronic
1184127035 22:42494780-42494802 GCGTGCGCACACACATGCATAGG + Intergenic
1184241815 22:43214994-43215016 ACACGTGCACACACAGGCATGGG - Intronic
1184355144 22:43974760-43974782 CTGTGTGCACCCACAGTGGTCGG + Intronic
1184707721 22:46225898-46225920 GTGTGTGTACACACAGGTGTGGG - Intronic
1185019012 22:48362667-48362689 CTGTGAGCACACAGAGGGCTAGG - Intergenic
950979084 3:17282314-17282336 CTTTCTGAACACACATGCATAGG + Intronic
952523520 3:34185868-34185890 CTGAGTGCACACACAGGTGAAGG - Intergenic
953452503 3:43016335-43016357 CTGTGTGAAGCCACAGGCAGAGG + Intronic
954244058 3:49316878-49316900 CTTTGTGCTCACACAGGCTATGG - Intronic
954364554 3:50139119-50139141 CTGTGTGCACGGACAGGCAGGGG + Intergenic
954800048 3:53181806-53181828 CTCTGAGCGCACACAGGCACTGG - Intronic
955227496 3:57073137-57073159 TTGTTTACTCACACAGGCATGGG - Intronic
957680474 3:83427045-83427067 CTGCTATCACACACAGGCATGGG + Intergenic
961115587 3:124326349-124326371 CTGTGTGCACAAAGAAACATTGG + Intronic
961301686 3:125925838-125925860 CTGCCTGCACACACAGACACGGG + Intergenic
961320424 3:126069295-126069317 CAGTGTGCACACAGAGCCACTGG + Intronic
961471102 3:127113459-127113481 CTGTGTGTACATTCAGGCCTGGG - Intergenic
962249958 3:133829915-133829937 ATGTGTGTACACACACACATGGG - Intronic
962442477 3:135435168-135435190 AAATGTGCACACATAGGCATAGG + Intergenic
964298942 3:155266250-155266272 CTGTGTGCACATGAAGGTATAGG + Intergenic
965733658 3:171798888-171798910 CTGTGTCCTCAGTCAGGCATCGG + Intronic
966314850 3:178633559-178633581 CTGTGTGCAGCCTCAGGCCTTGG - Intronic
967334371 3:188326069-188326091 CTGTGTGCAGACACAGATCTTGG + Intronic
969045088 4:4330871-4330893 CTGTCTGCAGACCCAGGAATAGG - Intergenic
969309313 4:6343913-6343935 CTTTTTGCACACACAGTCATAGG - Intronic
969406950 4:6999768-6999790 CTGTGTGCACACAGAACCACAGG - Intronic
969717483 4:8874846-8874868 GTGTGTGCCCTCACAGGGATGGG - Intergenic
970221429 4:13815876-13815898 GTGTGTGTACACACGGACATAGG - Intergenic
970719041 4:18964078-18964100 ATGTGTGCACACACAGAAACAGG - Intergenic
971159894 4:24123031-24123053 GTGTGTGCAAACACACGCACTGG + Intergenic
972763636 4:42131629-42131651 CTGTGTGCATCCACCGGCTTGGG - Intronic
976527635 4:86113098-86113120 CTCTGTGCACAGACACACATAGG - Intronic
977770601 4:100853431-100853453 ATGTGTGCACACACACACAATGG - Intronic
977890067 4:102299245-102299267 CTGTGTGTACATATATGCATGGG - Intronic
978018942 4:103785181-103785203 CTGTGAGCATACACATACATAGG + Intergenic
978708536 4:111747844-111747866 ATGTGTGCATACACATGTATTGG + Intergenic
979497921 4:121405499-121405521 CTATGAGGACACAAAGGCATAGG - Intergenic
980620714 4:135299256-135299278 ATGTGTGCACACACAGAGACAGG + Intergenic
981648572 4:147028596-147028618 CTCTCTGCAAACACATGCATAGG - Intergenic
982062647 4:151620274-151620296 CTGTGTCCACCCACAGGAAGAGG + Intronic
984195824 4:176657480-176657502 CTGGGTGTACACACAGTCCTGGG - Intergenic
985053071 4:186012238-186012260 GTGTGTGCACACACACGCATAGG + Intergenic
985289692 4:188375235-188375257 GTGTGAGCACAAACAGGCACAGG + Intergenic
985730571 5:1545262-1545284 CTGTGAACACACACCTGCATTGG + Intergenic
985848138 5:2369341-2369363 ATGCATGCACACACATGCATGGG + Intergenic
986257428 5:6111752-6111774 CCGTGTGCACACACAAGGAGAGG - Intergenic
986787979 5:11132496-11132518 CTGTGTGAAGACACAGGAGTTGG + Intronic
988029455 5:25743888-25743910 GTGTGTGGACACACAAACATGGG - Intergenic
989171345 5:38472673-38472695 CCGTGGGGACACACAGGCCTGGG + Intergenic
991964417 5:72077002-72077024 CTGTGTGCAAACAAAGCCCTGGG - Intergenic
993759662 5:91777815-91777837 CTGTGTGAACTCACTGCCATTGG + Intergenic
994758568 5:103825173-103825195 GTGTGTGTGCACACATGCATGGG - Intergenic
995010520 5:107252639-107252661 TTGTGTGCAAACACGTGCATGGG - Intergenic
997400827 5:133600671-133600693 ATATGTGCACACACACGCGTTGG + Intronic
998267507 5:140677200-140677222 ATATGTACACACACATGCATGGG - Intronic
998556062 5:143124782-143124804 CAGTGTGTGCACACAGGCGTGGG + Intronic
998571302 5:143260631-143260653 GTGTGTGCACACACACAAATGGG + Intergenic
999041384 5:148417012-148417034 CTGAGTGCAGGCACAGGAATTGG + Exonic
1000011376 5:157236435-157236457 CTGTGTACACACACAGACAGTGG - Intronic
1001210278 5:169804789-169804811 CTCTGTGTAATCACAGGCATAGG + Intronic
1001221744 5:169906318-169906340 CCATGTGCACACACTGGCTTGGG - Intronic
1001312665 5:170622669-170622691 CTGTGTGCAAAGACAGGCAGAGG + Intronic
1001408503 5:171494258-171494280 CTGTGAGAACACACACGCCTGGG + Intergenic
1002168196 5:177360991-177361013 CTGTGGGCAAACACAGGGACAGG + Intronic
1002774624 6:318299-318321 CTGTGTGCCAACCCTGGCATGGG - Intronic
1003094821 6:3133739-3133761 CTGTGTGCTCACACGGGCAGTGG - Intronic
1004866457 6:19857630-19857652 CCATGGGCACACACACGCATAGG + Intergenic
1005819092 6:29582436-29582458 CTGTGTGCAGTCACAGGTAGAGG + Intronic
1006022121 6:31123432-31123454 CTGAGTGCCCACACAGGCCAGGG + Intronic
1006837207 6:37006134-37006156 CTGTGCCCACACACAGGCTTTGG - Intronic
1007710979 6:43824142-43824164 CAGCAGGCACACACAGGCATGGG - Intergenic
1009495365 6:64339845-64339867 CTGTGAGGACACAAAGGCATAGG + Intronic
1010002565 6:70962480-70962502 TTGTGTGCACACGCATGCATGGG + Intergenic
1010454630 6:76040536-76040558 CTGTGTCCACCAACAAGCATTGG + Intronic
1011248939 6:85349895-85349917 CCGTGTGAAGACACAGGCAGAGG - Intergenic
1011339532 6:86298388-86298410 CTGTGTTCACAGACTGGCATAGG - Intergenic
1011550834 6:88529845-88529867 CTGTGTGCACAGGCAGGCCCCGG + Intergenic
1013193506 6:107824889-107824911 GTGTGTGCACACACCTGGATAGG - Intergenic
1013332256 6:109115517-109115539 CTGAGTGCACACACCGACAATGG - Intronic
1014445523 6:121522952-121522974 CTGTGGACACATAAAGGCATGGG + Intergenic
1015748761 6:136538970-136538992 CTGTGTGATCACACTGTCATAGG - Intronic
1016556889 6:145348732-145348754 CAGTGTTCACTCACAGGCTTTGG - Intergenic
1018151135 6:160940491-160940513 CTGGGGGCACAGACAGGCATGGG + Intergenic
1018266347 6:162028698-162028720 GTCTGGGCACCCACAGGCATTGG + Intronic
1019093066 6:169556069-169556091 CTGTGTGCACAGGCATGCCTTGG - Intronic
1019100833 6:169627893-169627915 CTGTGAGAACACACAGGGAAAGG + Intronic
1019767720 7:2863791-2863813 CTGTGGGAACACACAGGAAGTGG + Intergenic
1019778607 7:2926840-2926862 GTGTGTGCACACGCAGGCAAGGG + Intronic
1021365146 7:19769547-19769569 CTGAGTGCACAGACTGGCAGTGG - Intronic
1022344381 7:29500150-29500172 GTGTGTGCGCACACATGCGTAGG - Intronic
1022883242 7:34612844-34612866 CTGTCTGTACCCACATGCATGGG + Intergenic
1023579068 7:41662375-41662397 CTGTGAGCAGACACACACATTGG - Intergenic
1024266414 7:47610275-47610297 CTCTCTGCACAGACAGGCCTTGG - Intergenic
1024685838 7:51744371-51744393 CTGTCTGCAAAGACAGGCTTTGG + Intergenic
1024761942 7:52609366-52609388 CAGTGTGCACACCGAGGCATTGG - Intergenic
1028210535 7:88069017-88069039 CTGGCTGCACTCACAGGCCTGGG + Intronic
1028657023 7:93220250-93220272 CTGTGAGAATACACAGGAATAGG + Intronic
1029268941 7:99364905-99364927 CTGTGTGAAAACAGAGGCACTGG - Intronic
1030079273 7:105763294-105763316 CTGAGTGGACACAGAGGGATGGG - Intronic
1030145763 7:106353199-106353221 CTATGGGTACACAAAGGCATAGG - Intergenic
1030283696 7:107803218-107803240 CTGTGTGCATCCATATGCATAGG + Intronic
1030606559 7:111644418-111644440 CTGTGTGCACAGGCATGCATGGG - Intergenic
1030679521 7:112420212-112420234 ATGAGAGCACACACAGACATTGG + Intergenic
1033223484 7:139543825-139543847 CTGTGTGGACAGACAGGTAGAGG + Intronic
1033725734 7:144115839-144115861 GTGTGTGCGCGCACACGCATGGG - Intergenic
1034413713 7:150954413-150954435 CTGTGTGCAGACTCAGGGGTAGG - Intronic
1034491048 7:151393285-151393307 CTGTGTGCACACACAGGCATAGG - Intronic
1034644531 7:152633463-152633485 CGGTGGGCAGGCACAGGCATTGG + Intergenic
1034894071 7:154864130-154864152 GTGTGTGCACGCAGAGGCTTAGG - Intronic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1035399062 7:158552924-158552946 CTGTCTACACAAACAGGCTTGGG + Intronic
1035399085 7:158553083-158553105 CTGCGTACACACACATGCTTGGG + Intronic
1035399093 7:158553123-158553145 CCATGTACACACACAGGCTTGGG + Intronic
1035399154 7:158553504-158553526 CTGTGTACAGACACAGGCTTGGG + Intronic
1035649009 8:1250317-1250339 CGGTGTGCAGACCCAGGCACTGG - Intergenic
1035931815 8:3788354-3788376 CTGTGGGCACAGGGAGGCATGGG - Intronic
1036059227 8:5296158-5296180 CTGTGTGCAAGCACAGGCTGAGG + Intergenic
1036772221 8:11587161-11587183 GTGTGTGCGCACACACGCATGGG - Intergenic
1037023068 8:13998111-13998133 TTATGTACACACACATGCATGGG - Intergenic
1037761114 8:21742341-21742363 ATGTGTGCACGCAGAGGCAGAGG - Intronic
1038772275 8:30494117-30494139 CTGTGTGAACCAACAGACATGGG + Intronic
1038905100 8:31892457-31892479 CTGTGTACACACACAAAAATAGG + Intronic
1039766799 8:40637117-40637139 CTGTGTGCCCACATGGGAATGGG - Intronic
1039829321 8:41200478-41200500 CTGTGTCCACACCAAGGGATGGG - Intergenic
1041465253 8:58151934-58151956 CTGTTTTTTCACACAGGCATCGG - Intronic
1042036762 8:64541681-64541703 CTGTGTGCAGAGAAAGGCACAGG - Intergenic
1044274822 8:90286675-90286697 CTCTGTGCACACATAGAAATTGG - Intergenic
1046054392 8:109061574-109061596 CTCTGTAAACACACAGGCAAGGG + Intergenic
1047771718 8:128035265-128035287 CTGTGGGAACACACAGGGTTAGG + Intergenic
1048280125 8:133099471-133099493 CTGTGTGCAGACACATGTTTAGG - Intronic
1048646848 8:136430181-136430203 CTTTGAGGACACAAAGGCATAGG + Intergenic
1049128154 8:140810865-140810887 CAGGGTGCACACACAGACCTGGG + Intronic
1049531866 8:143159145-143159167 GTGTGTGCACGCACGTGCATGGG - Intronic
1050262042 9:3850790-3850812 CTCTGTGCACACACACGCCACGG + Intronic
1050919237 9:11179709-11179731 CTGGGAGCTCACACAGGCCTGGG - Intergenic
1053172857 9:35903305-35903327 GCGTGTGCACACACAGTTATTGG + Intergenic
1053645741 9:40118721-40118743 CTATGTGGACACACAGGCCCCGG + Intergenic
1053709063 9:40786975-40786997 CTGTATGCACACATATGCAGGGG + Intergenic
1053837446 9:42155474-42155496 CTATGGACACACACATGCATAGG + Intergenic
1054326754 9:63716622-63716644 CTATGTGGACACACAGGCCCTGG + Intergenic
1054418972 9:64907776-64907798 CTGTATGCACACATATGCAGGGG + Intergenic
1054538830 9:66257251-66257273 CTATGTGGACACACAGGCCCCGG - Intergenic
1055781665 9:79827843-79827865 CTCTGTGCACACACATCCCTGGG - Intergenic
1056588415 9:87944482-87944504 CTGTCTGCACACACGGACTTCGG - Intergenic
1056780184 9:89543323-89543345 CTGTGTGTGCATACATGCATAGG - Intergenic
1056953513 9:91064750-91064772 CTGTGTGCACACCCAGACTGTGG + Intergenic
1057048048 9:91900781-91900803 TTCTGTGCAAACAGAGGCATAGG + Intronic
1057292954 9:93818857-93818879 CTGTGCACACACGCAGGCCTTGG - Intergenic
1057339011 9:94182700-94182722 CCCTGTGCACACTCCGGCATGGG + Intergenic
1057995535 9:99819687-99819709 CCGTGCGCACACACATGCACGGG + Intergenic
1060075279 9:120585224-120585246 CTGTGGGACCAGACAGGCATGGG - Intergenic
1060797359 9:126521908-126521930 CTGTTTTCACACCCAGGCCTGGG - Intergenic
1061396445 9:130346399-130346421 CTGTGTGCACAGACCAACATGGG + Intronic
1061460908 9:130737788-130737810 CTGTTTTAACACACAGGCAAAGG - Intronic
1061894749 9:133641402-133641424 GGCTGAGCACACACAGGCATTGG - Intronic
1062357008 9:136169857-136169879 CAGTGTGCACAGCCAGGCAGAGG + Intergenic
1062690104 9:137837252-137837274 CTGGGTGTACAAACAGGTATTGG + Intronic
1202793524 9_KI270719v1_random:102193-102215 CTATGTGGACACACAGGCCCCGG + Intergenic
1185700973 X:2229568-2229590 GTGTGTGCACAGATATGCATAGG + Intronic
1187258454 X:17662181-17662203 CTGTGGGCACACACAGAAGTGGG + Intronic
1187465193 X:19520704-19520726 GTGTGTGTACACACAAGGATTGG + Intergenic
1188534995 X:31186867-31186889 CTGTAAGCACACACTGGCATGGG - Intronic
1189082775 X:37992287-37992309 ATGTGGGCACTCACAGGCAAGGG - Intronic
1192199103 X:69052977-69052999 GTGTGTGTACACACAGGAATGGG + Intergenic
1194748447 X:97656319-97656341 GTGTGTGTGCACACAAGCATAGG + Intergenic
1194806207 X:98331334-98331356 CTATGAGGACACAAAGGCATAGG + Intergenic
1195117063 X:101709729-101709751 GTGTGTGCACACGTATGCATGGG + Intergenic
1196010409 X:110880956-110880978 CTGTGTGCACACCCATGCCCTGG + Intergenic
1196664205 X:118299225-118299247 CTTTGTGTACTTACAGGCATGGG - Intergenic
1198942777 X:141976154-141976176 ATGAGTGCACACACAAGAATAGG - Intergenic
1198954632 X:142114810-142114832 CTCTGTGATCACACAGGTATAGG - Intergenic
1199202755 X:145112257-145112279 CTGTGTTCACAAACTGGCTTTGG + Intergenic
1199504346 X:148544481-148544503 ATGTGTGCACACTCACACATTGG - Intronic
1199694257 X:150332292-150332314 CTGTGTGAAAACAAAGGCAGAGG + Intergenic
1200067293 X:153509957-153509979 CTGTGTGCACCCACTTGCACTGG + Intergenic
1200375505 X:155775554-155775576 TTGTGAGCACACACACACATCGG - Exonic
1201859959 Y:18585981-18586003 CTCTGTGGACACAAAGGCAAAGG + Intronic
1201873362 Y:18734400-18734422 CTCTGTGGACACAAAGGCAAAGG - Intronic