ID: 1034494326

View in Genome Browser
Species Human (GRCh38)
Location 7:151410670-151410692
Sequence CCCGGCGGCTGGTTTCCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 52}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034494314_1034494326 7 Left 1034494314 7:151410640-151410662 CCCGGGGTCGGCCTGAGCCCTCC 0: 1
1: 0
2: 2
3: 19
4: 236
Right 1034494326 7:151410670-151410692 CCCGGCGGCTGGTTTCCATTAGG 0: 1
1: 0
2: 0
3: 2
4: 52
1034494315_1034494326 6 Left 1034494315 7:151410641-151410663 CCGGGGTCGGCCTGAGCCCTCCC 0: 1
1: 0
2: 3
3: 26
4: 281
Right 1034494326 7:151410670-151410692 CCCGGCGGCTGGTTTCCATTAGG 0: 1
1: 0
2: 0
3: 2
4: 52
1034494307_1034494326 28 Left 1034494307 7:151410619-151410641 CCTGGGGCGCCTCTAATGGACCC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1034494326 7:151410670-151410692 CCCGGCGGCTGGTTTCCATTAGG 0: 1
1: 0
2: 0
3: 2
4: 52
1034494317_1034494326 -4 Left 1034494317 7:151410651-151410673 CCTGAGCCCTCCCGGAGCGCCCG 0: 1
1: 0
2: 2
3: 19
4: 204
Right 1034494326 7:151410670-151410692 CCCGGCGGCTGGTTTCCATTAGG 0: 1
1: 0
2: 0
3: 2
4: 52
1034494320_1034494326 -10 Left 1034494320 7:151410657-151410679 CCCTCCCGGAGCGCCCGGCGGCT 0: 1
1: 0
2: 0
3: 13
4: 130
Right 1034494326 7:151410670-151410692 CCCGGCGGCTGGTTTCCATTAGG 0: 1
1: 0
2: 0
3: 2
4: 52
1034494311_1034494326 19 Left 1034494311 7:151410628-151410650 CCTCTAATGGACCCCGGGGTCGG 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1034494326 7:151410670-151410692 CCCGGCGGCTGGTTTCCATTAGG 0: 1
1: 0
2: 0
3: 2
4: 52
1034494313_1034494326 8 Left 1034494313 7:151410639-151410661 CCCCGGGGTCGGCCTGAGCCCTC 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1034494326 7:151410670-151410692 CCCGGCGGCTGGTTTCCATTAGG 0: 1
1: 0
2: 0
3: 2
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034494326 Original CRISPR CCCGGCGGCTGGTTTCCATT AGG Intronic