ID: 1034495254

View in Genome Browser
Species Human (GRCh38)
Location 7:151417037-151417059
Sequence CCCGTTCCTGCTCTGTGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034495254_1034495265 15 Left 1034495254 7:151417037-151417059 CCAGACCACAGAGCAGGAACGGG No data
Right 1034495265 7:151417075-151417097 CCAGTGGACTTCCTTGGTTGAGG No data
1034495254_1034495259 -1 Left 1034495254 7:151417037-151417059 CCAGACCACAGAGCAGGAACGGG No data
Right 1034495259 7:151417059-151417081 GGATCCCAGACGGAGCCCAGTGG No data
1034495254_1034495262 9 Left 1034495254 7:151417037-151417059 CCAGACCACAGAGCAGGAACGGG No data
Right 1034495262 7:151417069-151417091 CGGAGCCCAGTGGACTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034495254 Original CRISPR CCCGTTCCTGCTCTGTGGTC TGG (reversed) Intergenic
No off target data available for this crispr