ID: 1034496788

View in Genome Browser
Species Human (GRCh38)
Location 7:151427876-151427898
Sequence GCTCTTGGCTGTGGCTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034496788_1034496793 -7 Left 1034496788 7:151427876-151427898 CCCCAGCAGCCACAGCCAAGAGC No data
Right 1034496793 7:151427892-151427914 CAAGAGCCCTGCCAAGCCGATGG No data
1034496788_1034496799 16 Left 1034496788 7:151427876-151427898 CCCCAGCAGCCACAGCCAAGAGC No data
Right 1034496799 7:151427915-151427937 GACCCACGCAATCAATAAGCAGG No data
1034496788_1034496794 -6 Left 1034496788 7:151427876-151427898 CCCCAGCAGCCACAGCCAAGAGC No data
Right 1034496794 7:151427893-151427915 AAGAGCCCTGCCAAGCCGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034496788 Original CRISPR GCTCTTGGCTGTGGCTGCTG GGG (reversed) Intergenic
No off target data available for this crispr