ID: 1034496976

View in Genome Browser
Species Human (GRCh38)
Location 7:151428886-151428908
Sequence CAGATTAGGGAGCAGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 1, 2: 0, 3: 48, 4: 430}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034496969_1034496976 7 Left 1034496969 7:151428856-151428878 CCTCTTTCAGACAAAAAGCAGAT 0: 1
1: 0
2: 1
3: 23
4: 254
Right 1034496976 7:151428886-151428908 CAGATTAGGGAGCAGGGGGCTGG 0: 1
1: 1
2: 0
3: 48
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034496976 Original CRISPR CAGATTAGGGAGCAGGGGGC TGG Intronic
900238001 1:1601541-1601563 CAGAGGTGGGAGCTGGGGGCAGG - Intergenic
900397077 1:2457463-2457485 GACATTGGGGAGCAGGCGGCTGG - Intronic
900538099 1:3188825-3188847 GAGAGGAGGAAGCAGGGGGCGGG + Intronic
900658322 1:3771108-3771130 CAGAATGCGGAGCCGGGGGCAGG - Intronic
900865573 1:5266473-5266495 CAGCTTGGGGAGCAGGGAGTTGG - Intergenic
900940769 1:5797220-5797242 CTGAGTAGGGAGCAAGGGGCTGG - Intergenic
901026073 1:6279359-6279381 CAGATGAGGGAGGAAGGAGCAGG + Intronic
901506806 1:9690118-9690140 CCGAATAGGGGGCAGGGGGAGGG - Intronic
901656244 1:10771258-10771280 CAGGTTGGGGAGGTGGGGGCGGG + Intronic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
903059773 1:20661670-20661692 CAGACTAGGGGGCGGGAGGCCGG - Intergenic
903543370 1:24108901-24108923 CACGTTAGGGAGCAGGGCCCTGG + Intronic
904235856 1:29116581-29116603 CAGAGTAGAGAGCTGGGAGCAGG + Intronic
904600357 1:31669505-31669527 GGGATGAGGGAGAAGGGGGCAGG - Intronic
905403961 1:37720947-37720969 GAGATTAGGGAGCTTGGTGCTGG - Intronic
905825769 1:41025004-41025026 CACATCAGGGAGAAGGGGGTTGG - Intergenic
906197164 1:43936372-43936394 CAGATGGGGGTGCAGGCGGCGGG - Exonic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
907414273 1:54303374-54303396 CAGCCCAGGGGGCAGGGGGCAGG + Intronic
908318839 1:62961628-62961650 CAGAATGGGGAGGAGGGGGGTGG - Intergenic
911218905 1:95226189-95226211 CAGATTATGTTGAAGGGGGCAGG - Intronic
912449124 1:109758773-109758795 GAGACCAGGGAGCAGGGGGTGGG - Intronic
912906401 1:113712715-113712737 CAGATTAGTGAAGAGGGTGCTGG - Intronic
914247711 1:145898071-145898093 CAGTGTTGGGAGCAAGGGGCAGG + Intronic
915012468 1:152700090-152700112 CAGAGTATGGAACAGGGGTCCGG + Intergenic
915090483 1:153420807-153420829 TAGAGAAGGCAGCAGGGGGCTGG - Exonic
915311340 1:155007305-155007327 CAGCCTAGAGGGCAGGGGGCAGG - Intronic
916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG + Exonic
916142485 1:161711573-161711595 CAGACTATGGAGCAGGTTGCTGG + Intronic
916961962 1:169897396-169897418 AAGATTAGGGAGCAAGGAACAGG - Intergenic
917471639 1:175330805-175330827 CAGATTAGAGAGAAAGGGACTGG - Intronic
918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG + Intergenic
919817033 1:201448163-201448185 CAGTTTAGGGAGTGGGGAGCTGG + Intergenic
919920671 1:202164797-202164819 CAGAGGAGAGAGCAAGGGGCAGG - Intergenic
920269343 1:204751637-204751659 CAGACGAGGGAGCAGTGGGAGGG - Intergenic
921167667 1:212518571-212518593 TAGCTGAGGGAGGAGGGGGCAGG + Intergenic
921191560 1:212713420-212713442 CAGATGGGGGAGAAAGGGGCTGG - Intergenic
922775800 1:228213778-228213800 CCGAGAAGGGAGCCGGGGGCGGG + Intronic
923010373 1:230083428-230083450 AAGATGATGGAGCAGGGAGCTGG + Intronic
923010383 1:230083470-230083492 GGGATGATGGAGCAGGGGGCTGG + Intronic
923850678 1:237790875-237790897 CAGACAGGTGAGCAGGGGGCAGG - Intronic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063761394 10:9082376-9082398 GAGATTAGGAAGCAGAGAGCTGG - Intergenic
1063894977 10:10670499-10670521 CAAATGTGGGGGCAGGGGGCAGG - Intergenic
1065001409 10:21340866-21340888 GACAGTAGGGAGCAAGGGGCAGG + Intergenic
1065188957 10:23193333-23193355 CAGCTCAGGGAGAAGGGGTCGGG + Intronic
1065916044 10:30355778-30355800 CAGCCCAGGGATCAGGGGGCAGG - Intronic
1066443506 10:35460985-35461007 AAGAGTGGGGAGCAGTGGGCAGG + Intronic
1067673331 10:48346536-48346558 CAGACTGGGAAGCAGGGGGGAGG + Intronic
1068474360 10:57506877-57506899 CGGCTGAGGTAGCAGGGGGCTGG - Intergenic
1069096580 10:64266778-64266800 CACATTAGGAAGCAGGGAGAAGG - Intergenic
1069417534 10:68214232-68214254 CATATTAGGTAGCACAGGGCAGG - Intergenic
1069722617 10:70559497-70559519 GAGAATAGACAGCAGGGGGCGGG + Intronic
1069935003 10:71909329-71909351 CAGTTTGGTGGGCAGGGGGCTGG + Intergenic
1069949762 10:72010778-72010800 CAGAGGAGGGAGCAGTGGGGAGG - Exonic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1070514100 10:77187639-77187661 AATATGAGGGGGCAGGGGGCAGG + Intronic
1071307043 10:84308806-84308828 CAGTACAGGGAGCAGAGGGCAGG - Intergenic
1073298743 10:102457688-102457710 CAGATTAGAGAGCGTGGGGGTGG + Intergenic
1074870065 10:117569345-117569367 GATATTCTGGAGCAGGGGGCTGG - Intergenic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1075125088 10:119693080-119693102 CAGATGAGGGAGGAGAGGGCAGG - Intergenic
1075203954 10:120430761-120430783 CAGATTAAGTGGCATGGGGCAGG - Intergenic
1075341265 10:121648440-121648462 CAGACTAGGTAGTAGGAGGCAGG - Intergenic
1075359125 10:121813809-121813831 CAGATGAGAGAGCAGGGAGCTGG - Intronic
1075413191 10:122244175-122244197 CACATCAGGGAGCAGGGGTGGGG - Intronic
1075878874 10:125832483-125832505 CAGCTGAGAGAGCAGGGAGCAGG - Intronic
1076222500 10:128745763-128745785 CTGATAGGGGAGAAGGGGGCAGG + Intergenic
1076461470 10:130650131-130650153 CAGGTGAGGGGGCTGGGGGCGGG + Intergenic
1076713357 10:132351116-132351138 GTGATGTGGGAGCAGGGGGCGGG - Intronic
1077237300 11:1487923-1487945 CTGCTTAGGGAGGCGGGGGCCGG - Intronic
1077385899 11:2269406-2269428 CAGATTGGGGTGCTGGAGGCGGG - Intronic
1079242135 11:18728736-18728758 CATATTGGGGAGTGGGGGGCAGG - Exonic
1081022791 11:37968277-37968299 CTGATAAGGGGACAGGGGGCGGG + Intergenic
1081604184 11:44517087-44517109 GAGATTTGTGAGCAGGGGCCAGG + Intergenic
1081621079 11:44619464-44619486 AAAATTGGGGAGGAGGGGGCCGG + Exonic
1081656025 11:44858213-44858235 CAGATGTGGGAGTGGGGGGCAGG - Intronic
1083079625 11:60077156-60077178 GAGACTGGGGAGCAGGGGACGGG + Intergenic
1083117969 11:60482624-60482646 CATATTAGGGAACAGAGGGGAGG - Intergenic
1083221498 11:61255859-61255881 CAAATAAGGGAGCAGAGGCCTGG + Intergenic
1083413827 11:62512490-62512512 CAGTTTATGGAGTAGTGGGCAGG - Intronic
1083478757 11:62930189-62930211 CAGATTAAGGTGCAGGAGCCTGG - Intergenic
1084071085 11:66735352-66735374 AAAATTAAGGAGAAGGGGGCTGG + Intergenic
1084173139 11:67410143-67410165 CAGATGAGGGAGGAGGGGAAGGG - Intronic
1084408185 11:68991100-68991122 CAGGTGAGGGAGCGGGGTGCTGG + Intergenic
1085270117 11:75265270-75265292 CAGAGATGGGGGCAGGGGGCGGG - Exonic
1085282587 11:75340825-75340847 GAGATTGGGGAGCAGGAAGCTGG - Intronic
1085395510 11:76205296-76205318 CAGATAAGACAGCAGGGGGCAGG - Intronic
1086329932 11:85743884-85743906 CAGCTGAGGGAGGAGGGAGCAGG - Intronic
1088651065 11:111958500-111958522 GAGCTAAGGCAGCAGGGGGCTGG - Intronic
1089140400 11:116279517-116279539 CAGACTTGTGAGCAGGGAGCTGG + Intergenic
1089356321 11:117856388-117856410 AAGCTTCGGGAGCAGGGGGAGGG - Intronic
1089624676 11:119743487-119743509 CAGGTGAGGGAGGAGGGGGAAGG - Intergenic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1090657411 11:128856480-128856502 CAGAAGAGGGAGCAGGGGAGGGG + Intronic
1091134697 11:133178332-133178354 CAGAGTAGGGAGCCTGTGGCTGG - Intronic
1091264629 11:134261109-134261131 CAGAATTGGGAGCGAGGGGCAGG + Exonic
1091797449 12:3305419-3305441 CAGAATAGGGAGCAGGGGAGGGG - Intergenic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092287229 12:7135691-7135713 CAGGTTAGGCAGCAGGACGCTGG - Intronic
1093256211 12:16871492-16871514 TAGATTAGGGAGCAGGTGATGGG + Intergenic
1095054346 12:37582050-37582072 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1096809816 12:54162085-54162107 AAGAGAAGGGAGCAGGGGACAGG + Intergenic
1096813809 12:54188931-54188953 CAGGTGAGGAAGTAGGGGGCTGG - Exonic
1097156552 12:57016275-57016297 CTGATAGGGGAGCAGGGGACTGG - Intronic
1097182544 12:57179603-57179625 CAGGGTTGGGAGCAAGGGGCGGG - Intronic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1100247080 12:92769200-92769222 CAGATTTGGGAGGAGGGGAGGGG + Intronic
1101621650 12:106394727-106394749 CAGATTAGTGAGAAGATGGCAGG + Intronic
1101859836 12:108474193-108474215 GAGCTTGGGGAGCAGGGGCCGGG - Intergenic
1101910122 12:108855324-108855346 AAGGTTAGGGAGAATGGGGCAGG + Intronic
1103419890 12:120771917-120771939 CATATGAAGGAGCCGGGGGCAGG - Intronic
1103530296 12:121596439-121596461 CAGAACAGGGAACAAGGGGCCGG - Intergenic
1103607440 12:122097760-122097782 GAGAGTAGGGAGCTGGGAGCAGG - Intronic
1103748161 12:123140354-123140376 CAGGTTGGGGAGGAGGAGGCTGG - Intronic
1104674029 12:130700574-130700596 CAGAGGTGGGGGCAGGGGGCTGG + Intronic
1105638238 13:22236914-22236936 GATATTAGGGAGCAGGGCCCAGG + Intergenic
1105864952 13:24451190-24451212 CTGACCTGGGAGCAGGGGGCAGG + Intronic
1106141502 13:27015460-27015482 GACATTATGGAGCAGGGGGAGGG + Intergenic
1106444779 13:29817797-29817819 CAGATGGGAGAGCAGGGAGCTGG + Intronic
1110395318 13:75023331-75023353 CAGAATAGAGAGCAGAGAGCTGG - Intergenic
1112976609 13:105327231-105327253 GCTATTAGGGAGCAGGTGGCAGG + Intergenic
1113448595 13:110389360-110389382 CAGATTAGGGAGAAGGGTGATGG - Intronic
1113593752 13:111517883-111517905 CAGGTGAGGGAGCCGGGGGGTGG - Intergenic
1113593840 13:111518078-111518100 CAGGTGAGGGAGCCGGGGGGGGG - Intergenic
1114238877 14:20847635-20847657 CAGATCACGGAGCTGGGGCCAGG - Intergenic
1115188465 14:30719949-30719971 CAGAATTGGGGGCAGGGGGGTGG + Intronic
1116689134 14:48082125-48082147 CAGATTAGGGAGTAAGAGACAGG - Intergenic
1117211706 14:53507525-53507547 CAGAATAGGAAGCAGAGAGCTGG + Intergenic
1117733960 14:58751092-58751114 CAGCCAAGGCAGCAGGGGGCTGG - Intergenic
1119431034 14:74568027-74568049 CAGACTGGGGGGCAGGGGGTAGG + Intronic
1121436708 14:93925437-93925459 CACAGTAGGCAGCAGGGAGCTGG + Intronic
1121569911 14:94939763-94939785 CAGACTAGAGAGCAAGGGTCGGG + Intergenic
1121617255 14:95320915-95320937 CTGAGCTGGGAGCAGGGGGCTGG - Intergenic
1122969821 14:105147979-105148001 CAGACCCGGGGGCAGGGGGCAGG + Intronic
1122974114 14:105164079-105164101 CGGGTTGGGGAGCAGGCGGCAGG - Intronic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1124239337 15:28017051-28017073 CAGCCTGGGGAGCGGGGGGCGGG + Intronic
1125339198 15:38657884-38657906 CAGATGAGGAAGCAGGCTGCAGG + Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125979176 15:43984403-43984425 CAGCTTAGGCACCAGTGGGCAGG + Intronic
1126928740 15:53622622-53622644 CTGAGGAGGGAGCAGGGGGAGGG + Intronic
1127377082 15:58394755-58394777 CAGAGTTGAGAGCAAGGGGCTGG + Intronic
1127475231 15:59326885-59326907 TAGAGTCGGGGGCAGGGGGCAGG - Intronic
1127541282 15:59941369-59941391 CAGAAGAGGGAGCAGTGGGGTGG - Intergenic
1128056412 15:64702984-64703006 CAGATGAGGGAGGATGGGGGCGG + Intronic
1128126624 15:65197822-65197844 CAGAGTAGGCATCAGGGGACTGG + Exonic
1128240272 15:66096751-66096773 TAGGATCGGGAGCAGGGGGCAGG - Intronic
1128285689 15:66435154-66435176 AAGATCAGTGAGCTGGGGGCTGG + Exonic
1128373647 15:67059696-67059718 CAGCTTAGGGAACAGAGGGCAGG - Intergenic
1129843853 15:78759335-78759357 ACCATTAGGGCGCAGGGGGCGGG + Exonic
1130284139 15:82541301-82541323 CAGAGTTGGAAGAAGGGGGCAGG - Intronic
1130924612 15:88375658-88375680 CAGCTCAGGGGGCAGAGGGCAGG + Intergenic
1131145043 15:90005358-90005380 CAGGTGAGGCAGGAGGGGGCTGG + Intronic
1132186679 15:99806946-99806968 CAGCTGAGGGAGGAAGGGGCGGG - Intergenic
1132265233 15:100464436-100464458 CAGCTGAGTGTGCAGGGGGCAGG - Intronic
1132310462 15:100853915-100853937 CATAGCAGGGAGCTGGGGGCAGG - Intergenic
1132429008 15:101745765-101745787 CAGCTGAGGGAGGAAGGGGCGGG + Intergenic
1132885834 16:2181600-2181622 CTGAGTGGGGCGCAGGGGGCAGG + Intronic
1133749341 16:8712644-8712666 CCGATTTGGGGGCTGGGGGCTGG + Intronic
1137382613 16:48013005-48013027 TAGCTTGGGGGGCAGGGGGCGGG + Intergenic
1137507107 16:49063691-49063713 CAGTTAAGGGAGCAGAGGGGAGG + Intergenic
1137834027 16:51573238-51573260 CAGAGTAGGGAGCAGAAGGTGGG + Intergenic
1137845449 16:51683694-51683716 AAGATCAGGGAGCTGGGAGCAGG + Intergenic
1138084259 16:54119431-54119453 CAGAGTTGGGGGCAGGGGGAAGG - Exonic
1138417780 16:56881107-56881129 CTGCATAGGGAGCAGGGGCCAGG - Intronic
1139522080 16:67489235-67489257 CAGATAAGGGAGCAAGGCCCAGG - Intergenic
1140038109 16:71386430-71386452 CAGAATCGGGAGCTGGGGGAGGG + Intronic
1140357047 16:74315377-74315399 TAGAATAGGGAGGAGGGGGAAGG - Intergenic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141229652 16:82153450-82153472 CAGATTGTGGAGCAGGGAGTGGG + Intronic
1142107775 16:88315564-88315586 CAGAGGAGGGAGCAGGGCCCAGG + Intergenic
1142123578 16:88399226-88399248 CACATGAGGGAGCAGAGGGGAGG - Intergenic
1142290915 16:89193260-89193282 GAGGTTAGGGAGGAGGGGGCCGG - Intronic
1142889496 17:2933620-2933642 CAGGAAAGTGAGCAGGGGGCTGG - Intronic
1143155541 17:4833802-4833824 GAGAGAAGGGAGCAGAGGGCGGG - Intronic
1143385603 17:6528384-6528406 ACCCTTAGGGAGCAGGGGGCTGG - Intronic
1143573988 17:7779113-7779135 CAGACTAGGGGGCAGGGAGGAGG - Intronic
1143659928 17:8318513-8318535 AATGGTAGGGAGCAGGGGGCTGG + Intronic
1144465350 17:15492848-15492870 TGGACTAGGGGGCAGGGGGCAGG - Intronic
1144650199 17:17002447-17002469 CAGGCTGGGGTGCAGGGGGCAGG - Intergenic
1144714450 17:17424355-17424377 CAGCTGAGGCAGCAGGGGACTGG - Intergenic
1145773159 17:27508046-27508068 CAGGTTGGGGAGCAGGAGACTGG - Intronic
1145982759 17:29023761-29023783 CTGATGTGGGAGTAGGGGGCAGG - Intronic
1146272499 17:31493563-31493585 AAAACGAGGGAGCAGGGGGCAGG - Intronic
1146916856 17:36683481-36683503 CAGATTACAGAGCAGGAGGCTGG - Intergenic
1148467390 17:47873050-47873072 CAGAGGAGGGAGCAGGAGCCAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148751832 17:49949792-49949814 CAGGTTCTTGAGCAGGGGGCAGG - Intergenic
1148844978 17:50524546-50524568 CAGATTAGGAAGAAGGGGCAGGG - Intronic
1149567972 17:57652972-57652994 CAGTTCAGGGAGCAGGGGTGGGG - Intronic
1149572268 17:57680884-57680906 CAGATGTGGGAGCAGGGTGGGGG - Exonic
1149596666 17:57868342-57868364 CCGGAGAGGGAGCAGGGGGCAGG + Intronic
1150008985 17:61487531-61487553 CTGATTAGGGAGGACCGGGCTGG + Intergenic
1150176492 17:63062647-63062669 CAAAATGGGGAGGAGGGGGCTGG - Intronic
1150426969 17:65084883-65084905 CAGATTAGGGAGTAGATGGGAGG + Intergenic
1150479640 17:65499396-65499418 CGGGTTAGGGAGCAGGAGGCTGG - Intergenic
1151155068 17:72118314-72118336 CAGGTCAGGGAGGAGGGGTCGGG + Intergenic
1151212523 17:72555159-72555181 CAGATGATGAAGCTGGGGGCGGG + Intergenic
1152593964 17:81229281-81229303 CAGATGAGGGAGCAGGGCTCCGG + Exonic
1152777836 17:82213371-82213393 CTGATTAGGGAACTGGGGGAAGG + Intergenic
1153432397 18:5032161-5032183 CAGGGTGGGGAGCAGGGTGCAGG - Intergenic
1154172926 18:12063780-12063802 TAGAGAAGGGAGCAGGTGGCCGG + Intergenic
1157357643 18:46950071-46950093 TAGATTAGGGAGAATGTGGCTGG - Intronic
1157368102 18:47085044-47085066 CAGCATAGGGAGCTGGGGCCGGG - Intronic
1157725325 18:49959491-49959513 CAGGTGAGGAAACAGGGGGCGGG + Intronic
1160448608 18:78946916-78946938 AAGATGAGGGAGGAGGGGGAGGG + Intergenic
1160605727 18:80048334-80048356 CAAGTTAGGGGGCGGGGGGCAGG - Intronic
1161243272 19:3234825-3234847 CAGGTGAGGGATGAGGGGGCTGG - Intronic
1162129914 19:8520100-8520122 GGGATTGGGGTGCAGGGGGCAGG + Intergenic
1162534341 19:11254027-11254049 CAGATGAGGGAGCAGAGGCCAGG - Intronic
1162952763 19:14081766-14081788 CAGAATAGGGGGCAGGGGAGGGG - Exonic
1163460808 19:17436475-17436497 CAGACCAGGGAGCATGGGGAAGG - Exonic
1163560188 19:18014395-18014417 GAGAGTGGGGAGCAGGGGGCTGG + Intergenic
1163659397 19:18567788-18567810 CAGTTTACAGAGCAGGGAGCTGG + Intronic
1163743075 19:19028682-19028704 CAGATTAGGGGGCCGTGGGTGGG - Intronic
1163821626 19:19499487-19499509 CAGACTTGGGAGCAGCGGGGTGG + Intronic
1164541228 19:29122909-29122931 AAGATGATGGAGCAGGCGGCAGG - Intergenic
1165573026 19:36791484-36791506 CAAATTACGGAGGAGGGGGCAGG - Intergenic
1165632347 19:37312502-37312524 CAAATTATGGAGGAGGGGGCAGG - Intergenic
1166195555 19:41203467-41203489 CTGAATCGGGAGCTGGGGGCTGG + Exonic
1166894833 19:46016766-46016788 CAGTCAAGGCAGCAGGGGGCTGG - Exonic
1167465852 19:49650944-49650966 CAGAGGAGGGGGCAGGGGGTGGG - Exonic
1167648254 19:50717212-50717234 CAAAGTGGGGCGCAGGGGGCGGG - Intronic
1168008485 19:53510332-53510354 CAGATTAGGGAACTCGGGGTAGG + Intergenic
924960813 2:32916-32938 GAGGTTAGGGGGCAGGGGTCGGG - Intergenic
925589225 2:5493498-5493520 CAAGTGAGGGAGAAGGGGGCCGG - Intergenic
926044959 2:9703592-9703614 CAAAATAGGGAGCAGTGGGGTGG - Intergenic
926156008 2:10454397-10454419 CAGCCGAGGGAGCAGGGGCCTGG + Intergenic
926221776 2:10941048-10941070 CAGGTGAGGGAGCAGGGAGAGGG + Intergenic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
927889626 2:26740188-26740210 AAGTTGAGGGGGCAGGGGGCGGG + Intergenic
927896439 2:26785797-26785819 CAGATTGGCAAGCAGGGGGCAGG + Intronic
928434534 2:31246022-31246044 CAGAGTAGGGAGCAGAGGAAGGG + Intronic
928458740 2:31449911-31449933 CAGAGGAGGTAGCATGGGGCAGG + Intergenic
928869748 2:35962198-35962220 TGGATCAGGGAGCAGGGAGCAGG + Intergenic
929123762 2:38504364-38504386 CACATGAGGCAGCAGGTGGCTGG + Intergenic
929487711 2:42369701-42369723 CAAATTAGAGAGCTGGGGGAGGG + Intronic
931282229 2:60804526-60804548 GGGCTTAGGCAGCAGGGGGCTGG + Intergenic
931837155 2:66111149-66111171 CTAATTAGGGTGCAGAGGGCTGG - Intergenic
932102663 2:68914823-68914845 CAGATTAGAAAGCAGGAGGAGGG - Intergenic
932224514 2:70029068-70029090 CAGAGTAGGGGGTAGGGGACTGG + Intergenic
933763981 2:85694887-85694909 GAGAGCAGGGTGCAGGGGGCAGG - Intronic
934606927 2:95702566-95702588 TAGATTGGGGAGCAGGGGTCAGG + Intergenic
934731777 2:96663385-96663407 CAGTGGAGGGAGGAGGGGGCAGG + Intergenic
934935037 2:98459270-98459292 CAGGGTAGGGAGGAGTGGGCGGG - Intronic
936540321 2:113344690-113344712 TAGATTGGGGAGCAGGGGTCAGG + Intergenic
937543677 2:122989294-122989316 GAGCTGAGGCAGCAGGGGGCTGG - Intergenic
937710934 2:124979147-124979169 CAGATTAGAGAGAAGGTAGCTGG + Intergenic
937908771 2:127065293-127065315 CAGAATGGGGAGCGGGGGGTGGG + Intronic
938398204 2:130965870-130965892 GAGAGTTGGGAGCAGGGGGTGGG + Intronic
938598296 2:132811611-132811633 CTGTTGAGGGGGCAGGGGGCAGG - Intronic
940418965 2:153456106-153456128 CACATGATGGGGCAGGGGGCGGG + Intergenic
940662611 2:156566023-156566045 CAGTTTTGTGAGCAGAGGGCAGG - Intronic
942799044 2:179855908-179855930 CAGATTTGAGAGCTTGGGGCAGG - Intronic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
943778338 2:191792851-191792873 TAGATTGGGGAGCAGGGAGAAGG + Intergenic
944857034 2:203777893-203777915 CATCTCAGGGGGCAGGGGGCAGG + Intergenic
946021649 2:216644276-216644298 AAGATTGGGGAGAAGGGGGCAGG + Intronic
946321362 2:218956264-218956286 CAGATTAGGGAGAAGCAGACAGG + Intergenic
946868585 2:224065308-224065330 AAAATTAGGGAGATGGGGGCAGG + Intergenic
948002503 2:234579920-234579942 CAGAATGGGGAACAGGGGACAGG + Intergenic
948465867 2:238151348-238151370 CAGAGAGGGGAGCCGGGGGCCGG + Exonic
948559356 2:238841038-238841060 AAGAATAGGGTGTAGGGGGCTGG - Intergenic
949003001 2:241628129-241628151 CAGAATGGAGAGAAGGGGGCTGG - Intronic
1169076551 20:2763403-2763425 CAGAATAGTCAGCAGAGGGCTGG - Intergenic
1169775153 20:9244086-9244108 AAGATTAGGGATCAGGGAGAGGG - Intronic
1171527913 20:25830297-25830319 CAAATTATGGAGGAGGGGGCAGG - Intronic
1171548913 20:26025583-26025605 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1172245554 20:33443244-33443266 CAGCCGAGGGCGCAGGGGGCTGG - Intronic
1172468395 20:35173872-35173894 CAGAAAAGGCAGCAGGGGCCAGG + Intronic
1172519962 20:35560021-35560043 CAGAGTAGGGAACTGGGGGACGG + Intergenic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1173617809 20:44414273-44414295 CAGAGGAGGGGGCAGGGGGCAGG + Intronic
1174581702 20:51576855-51576877 CAGACTGGGGAGGAGGGGCCTGG + Intergenic
1175081557 20:56424878-56424900 TAGATGAGGGAGGAGGTGGCTGG + Intronic
1175575297 20:60056459-60056481 CAGAGTGGGGAGCTGGGAGCAGG + Intronic
1175601343 20:60276267-60276289 CAGGGTAGGGAGGAGGGAGCTGG - Intergenic
1175715106 20:61250276-61250298 CAGAGGAGGGTGCAGAGGGCAGG - Intergenic
1176126017 20:63475131-63475153 CAGAGGAGGGGACAGGGGGCAGG - Intergenic
1176198300 20:63847986-63848008 GAGAGGAGGGAGCTGGGGGCTGG + Intergenic
1178074928 21:29006094-29006116 CAGGTAAGGGAGAAGGGGGTTGG + Exonic
1178457855 21:32772203-32772225 CAGATGAGGGAGGAGGAGGAGGG + Intergenic
1178724122 21:35036074-35036096 CAGAAGAGGGAGCAGGGAGCAGG + Intronic
1179469561 21:41601520-41601542 CTGGTTAGGGGGCAGAGGGCTGG + Intergenic
1179499658 21:41799929-41799951 CAGTTTCGGGGGCAGGGGCCAGG - Intronic
1179659075 21:42863169-42863191 CAGATTTGGGAGCAGGGGAGTGG - Intronic
1181280137 22:21713961-21713983 CAAATTCGAGAGCACGGGGCTGG + Intronic
1181313201 22:21956567-21956589 CAGAGATGGGAGCAGGGAGCAGG + Intergenic
1181346307 22:22222639-22222661 CAGAGATGGGAGCAGGGAGCAGG + Intergenic
1181386092 22:22546908-22546930 CAGATTTGGGAGTTGGGGGTAGG - Intergenic
1181580902 22:23827559-23827581 CATAAGAGAGAGCAGGGGGCAGG - Intronic
1181863241 22:25835441-25835463 AAGGTAAGGAAGCAGGGGGCTGG + Exonic
1182324713 22:29503894-29503916 CAGATTAGGGGGAAAGGGACTGG - Intergenic
1183098552 22:35569336-35569358 CAGATCTGAGAGCAGGGGCCTGG - Intergenic
1183671396 22:39274836-39274858 AAGAGAAGGGGGCAGGGGGCTGG + Intergenic
1183858721 22:40653630-40653652 GAGAGTAGGGAGCCGAGGGCAGG + Intergenic
1184035899 22:41917942-41917964 CAGCATTGGGAGCTGGGGGCGGG - Intergenic
1184634806 22:45818629-45818651 GGGATCAGGGATCAGGGGGCAGG + Intronic
1184704624 22:46202145-46202167 CAGAGGAGGCAGGAGGGGGCTGG - Intronic
1184766546 22:46575518-46575540 CAGAGTAGGGAGCGGTAGGCAGG + Intergenic
1184841093 22:47052795-47052817 CTGATTGGGGAGCAGTGGCCTGG - Intronic
1184932232 22:47690052-47690074 GAGATAAGGAAGCAGGGGGTCGG + Intergenic
1184988046 22:48148838-48148860 CAGAGTGGGGGGCAGGGGGAAGG - Intergenic
1185412844 22:50695041-50695063 AAGATCAGGTAGGAGGGGGCTGG + Intergenic
949586894 3:5449557-5449579 CAGATTTGGGGGAAGGGGGTGGG + Intergenic
950503164 3:13377129-13377151 CAGCTTGGGGAAAAGGGGGCGGG + Intronic
952777283 3:37058771-37058793 CAGAGTAGGTACCAGGGGACAGG - Exonic
953058182 3:39405010-39405032 TACATTTGGGTGCAGGGGGCAGG + Intergenic
953114990 3:39984065-39984087 CAGATTGGGAAGCAGAGGCCAGG - Intronic
953642730 3:44724823-44724845 TAAATTAGGGAGTAGGGGACTGG - Intergenic
953662829 3:44903661-44903683 CAGAGTTGTGTGCAGGGGGCAGG - Intronic
953850485 3:46462792-46462814 CAGAGAAGGGGGCAGGGAGCTGG + Intronic
954115389 3:48464371-48464393 CAGAATAGGGGGCTGGAGGCAGG + Intronic
954144703 3:48628817-48628839 CAGCCTGGGGAGCAGAGGGCTGG - Intronic
955521098 3:59776360-59776382 CTGATTAGGGACCTGAGGGCAGG + Intronic
955820973 3:62895059-62895081 CAGATAAGGGAGCTCGGGGGTGG + Intergenic
956527340 3:70179456-70179478 CAGCTGAGGGAGCAGGGCGCTGG - Intergenic
956975715 3:74576073-74576095 CACATTAGGAGGCAGAGGGCTGG - Intergenic
957610016 3:82453833-82453855 TAGAGCAGGGAGAAGGGGGCAGG - Intergenic
958269715 3:91484562-91484584 AAGATTAGGGAGCTGAGGGAGGG - Intergenic
961642399 3:128372815-128372837 CAGGTTAGGGTGAAGGGTGCTGG + Intronic
962324785 3:134423901-134423923 CAGAGAGGGGAGCAGGGGCCAGG - Intergenic
963199128 3:142568849-142568871 GAGATGAGGCAGCAGGGGGCTGG - Intronic
963686620 3:148443036-148443058 GAAATTTGGGAGCAGGAGGCAGG + Intergenic
963757079 3:149246159-149246181 CAGATTTGGGAGCTGGAGGTGGG - Intergenic
964427623 3:156569762-156569784 CACATTCGGGAGCCAGGGGCAGG + Intergenic
965438675 3:168685710-168685732 GAGATTGGGGAGCAGCGGGATGG - Intergenic
965599818 3:170443415-170443437 GAGATTATGGGGCAAGGGGCAGG - Intronic
966075616 3:175933476-175933498 CAGGAAAGGGAGCAGGGGACAGG + Intergenic
966886148 3:184379193-184379215 AAGATTAGGAAGGAGGGTGCTGG + Intronic
967920013 3:194607619-194607641 CAGATAAGGAAACTGGGGGCTGG - Intronic
968233556 3:197017966-197017988 CTGAGCAGGGGGCAGGGGGCAGG + Intronic
968522299 4:1039535-1039557 CAGACAAGGGCGCAAGGGGCAGG - Intergenic
968568511 4:1327396-1327418 CAGCTGCAGGAGCAGGGGGCGGG + Intronic
969039122 4:4280935-4280957 CAGAATAGGTAGCAGGAGGAAGG - Intronic
969311476 4:6355238-6355260 CTGATCAGGGCTCAGGGGGCAGG + Intronic
970410777 4:15806183-15806205 CAGATAAGAGGGCACGGGGCAGG - Intronic
972620061 4:40738602-40738624 CAGATTTGGGAGAAGGGAGCAGG - Intergenic
973635627 4:52859768-52859790 CAGATTAAAGATCAAGGGGCAGG - Intergenic
973656133 4:53049719-53049741 CAGATTAGGCAGCTTGGTGCAGG - Intronic
974857366 4:67476706-67476728 CAGGGTAGGCAGCAAGGGGCAGG + Intronic
976163125 4:82225054-82225076 CAGATGAAGGAGCAGTGGTCTGG - Intergenic
979823889 4:125208858-125208880 CAGTTTAGGGAGCAAGAGGGAGG + Intergenic
982234749 4:153242032-153242054 CCCATTATGGAACAGGGGGCAGG + Intronic
982918935 4:161249961-161249983 AAGCTGAGGCAGCAGGGGGCTGG + Intergenic
984179504 4:176464314-176464336 CAGATGTGGGAGCAGGAGGATGG + Intergenic
984492233 4:180449589-180449611 CTGACTAGGCAGCAGGGAGCTGG - Intergenic
985704853 5:1394401-1394423 CAGAGCCGGGAGCAGGGAGCAGG + Exonic
987627516 5:20421198-20421220 CATATTCAGGAGCAGGGAGCAGG + Intronic
988824079 5:34916859-34916881 CAGATTGGGGGGCAGGGGGAGGG + Intronic
989200331 5:38756814-38756836 GAGATCAGGGAGCCGGGGGGTGG - Intergenic
989683317 5:44055187-44055209 GTGGTTAGGGGGCAGGGGGCTGG + Intergenic
990616426 5:57513131-57513153 TAGATTAGGGGACAGGGGGCCGG - Intergenic
991560604 5:67947602-67947624 CAGAATGGGGAGCAGGGGCCAGG - Intergenic
991584828 5:68191237-68191259 CTGCTTAGGGGGCAGGAGGCAGG - Intronic
992482962 5:77169276-77169298 CAGCTTTGGGAGGTGGGGGCTGG + Intergenic
992669901 5:79048878-79048900 AAGATTAGGGAGCAGAGATCTGG + Intronic
993555431 5:89330891-89330913 CAAATAAGGGAGCAGAGGGGAGG - Intergenic
995001949 5:107143878-107143900 CAGATTGGGGAGCAGCAGGCAGG + Intergenic
995002079 5:107145408-107145430 CAGATTGGGGAGCAGCAGGCAGG + Intergenic
995386545 5:111595794-111595816 GGGATGAGGCAGCAGGGGGCTGG - Intergenic
996031203 5:118705841-118705863 CAGTTTAAGGAGCAGGGAGAAGG - Intergenic
997045545 5:130312524-130312546 AAGATTAGGGAACTGGAGGCTGG - Intergenic
997403505 5:133622052-133622074 GAGATTAGGGATAAGGGGGGAGG - Intergenic
1000626460 5:163545012-163545034 TAGATTAAAGAGCAGGCGGCCGG - Intergenic
1002661030 5:180791271-180791293 CAGGTCAGGGAGAAGGGGTCTGG + Exonic
1004354795 6:14921562-14921584 CAAATGAGGGAGAAGGGGGAAGG + Intergenic
1005083659 6:21981720-21981742 CAGAGTAGGAAGGAGGCGGCAGG - Intergenic
1005083684 6:21981850-21981872 CAGATCAGGAAGGAGGAGGCAGG - Intergenic
1006515317 6:34542180-34542202 CAGCTTTGGGGGCAGGGGCCGGG + Intronic
1007181293 6:39931196-39931218 CAGATTAGGGTGAAGGGGGTGGG + Intronic
1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG + Intronic
1007694662 6:43724683-43724705 GAGACTAAGGAGCAGGAGGCAGG - Intergenic
1008985442 6:57536810-57536832 AAGATTAGGGAGCTGAGGGAGGG + Intronic
1009173474 6:60429758-60429780 AAGATTAGGGAGCTGAGGGAGGG + Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1011828197 6:91335758-91335780 CTGATTGGGAAGCAGGGGGGAGG + Intergenic
1013437570 6:110126831-110126853 CAGATTAGGGAGAAGGAGACAGG - Intronic
1014089242 6:117384816-117384838 CAGATTAGAGGGCAGGAGGAAGG + Intronic
1015357709 6:132298524-132298546 CAGATCAGCCAGCAGGGGTCAGG - Intronic
1016356120 6:143220083-143220105 TAGCTTAGGGGGCAGGGGGCAGG + Intronic
1017877822 6:158538121-158538143 CAGAGTAGGGGGCGGGGGACGGG - Intronic
1018623042 6:165750376-165750398 CAGCTCAGGGAGCAGGAGTCTGG + Intronic
1018926189 6:168208654-168208676 CAGAAAAGTGAGCAGGGGCCGGG + Intergenic
1019227799 6:170529579-170529601 GAGAGAAGGGAGCAGGGGACTGG - Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019936431 7:4261272-4261294 CAGATGAGGGAGCAGCTGGCAGG + Intronic
1022423513 7:30246231-30246253 GGGCTGAGGGAGCAGGGGGCTGG + Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023682359 7:42700698-42700720 TCTATTAGGGAGCAGGGGGACGG - Intergenic
1023792389 7:43763208-43763230 CAGAGCTGGGAGGAGGGGGCTGG + Intronic
1024030303 7:45455047-45455069 CGGATGAGGGAGTAGGGGGATGG - Intergenic
1024279286 7:47706176-47706198 CAGAATAGAGAGCTGGGTGCAGG + Intronic
1024576472 7:50768590-50768612 CAGATTAGGGAGCATGTTGGAGG - Intronic
1025212741 7:57030008-57030030 CAGGTTGGGGGGCGGGGGGCAGG + Intergenic
1025297730 7:57789586-57789608 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1025611370 7:63077945-63077967 CAGAGTGGGCAGCAGCGGGCAGG + Intergenic
1025659212 7:63546816-63546838 CAGGTTGGGGGGCGGGGGGCAGG - Intergenic
1026268355 7:68814886-68814908 CAGAATAGGGTGCAGGGCGTGGG - Intergenic
1026850732 7:73721680-73721702 CACACTGGGCAGCAGGGGGCTGG - Intergenic
1029954133 7:104619856-104619878 CAGGTGGGGCAGCAGGGGGCGGG + Intronic
1031743785 7:125468381-125468403 GAGCCTAGGTAGCAGGGGGCTGG + Intergenic
1032389164 7:131544573-131544595 CAGATCAGGGAGGCGTGGGCAGG + Intronic
1032905486 7:136359763-136359785 CAGGTGAGGGAGCAGGTGGTTGG + Intergenic
1033343129 7:140507257-140507279 CAGATGGGGGAACAGGAGGCCGG + Intergenic
1034219025 7:149430283-149430305 CAGAGGAGGGAGCAGAGGTCTGG - Intergenic
1034390650 7:150785024-150785046 CAGCTAAGGTAGCAGAGGGCAGG + Intergenic
1034496976 7:151428886-151428908 CAGATTAGGGAGCAGGGGGCTGG + Intronic
1034744172 7:153507679-153507701 CAGATGAGGAAGCTGGGGCCAGG + Intergenic
1034820458 7:154211976-154211998 GAGATGAGGGAGGAAGGGGCAGG - Intronic
1035205041 7:157289692-157289714 CAGAGGAGGGATCAGAGGGCGGG + Intergenic
1035459608 7:159030880-159030902 CAGATACGGGAGCAGGCGGGAGG - Intronic
1035538744 8:414866-414888 CAGAGTAGGAAGCAGGGCGGGGG - Intronic
1037505068 8:19521385-19521407 AAGAGTAGGGCCCAGGGGGCCGG + Intronic
1037948306 8:23003203-23003225 GGGATTAGGGAGCAGGGGCAGGG - Intronic
1038455645 8:27670664-27670686 GAGATTAGGGAACAAGGGGCTGG - Intronic
1038455653 8:27670716-27670738 GAGGTTAGGGAACAAGGGGCTGG - Intronic
1038720152 8:30027924-30027946 AAGATCAGTGAGCTGGGGGCTGG + Intergenic
1039783756 8:40813989-40814011 GAGGTCGGGGAGCAGGGGGCTGG + Intronic
1041170418 8:55136185-55136207 CAAATTAGTGAGCATGGGCCAGG - Intronic
1041227526 8:55715396-55715418 CAAACTAGGGAGCAGTGAGCAGG - Intronic
1041318934 8:56593818-56593840 TAGGTTAGGGAGAAGGGGGTTGG + Intergenic
1042391541 8:68241330-68241352 CAGATTAGGGAGAAGGAGACAGG + Intergenic
1044693880 8:94903978-94904000 AAGACTAGGGAGCCAGGGGCAGG - Intronic
1045909880 8:107394523-107394545 CAGAATAAGGAGCTGGGGGGAGG + Intronic
1047643283 8:126843742-126843764 CAGACCAGGGAGCAAGGGGCTGG - Intergenic
1049145651 8:141000212-141000234 CAGAGTCGGGGGCTGGGGGCGGG + Intronic
1049239242 8:141528586-141528608 CAGAGGAGGGAGGAGGGAGCAGG + Intergenic
1049243510 8:141550367-141550389 CAGCAGAGGGAGCAGGGGCCAGG + Intergenic
1049422947 8:142524935-142524957 CAGAGTAGAGAGGTGGGGGCTGG - Intronic
1049542260 8:143213968-143213990 CAGATCAGGCAGCAGGGCTCTGG - Intergenic
1050886141 9:10768755-10768777 CAGAGTAGGGGGCAGGGAGATGG - Intergenic
1051418525 9:16869505-16869527 CACATTAGGGAGCAGGGAAGAGG + Intronic
1051438487 9:17057424-17057446 CAGATGAGGGAGGTGGGGGTGGG + Intergenic
1053464148 9:38292652-38292674 CAGATCGGGGTGCAGGGGGAGGG + Intergenic
1053795877 9:41726445-41726467 CAAATTATGGAGGAGGGGGCAGG - Intergenic
1054149302 9:61588428-61588450 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1054184284 9:61938516-61938538 CAAATTATGGAGGAGGGGGCAGG - Intergenic
1054469064 9:65519539-65519561 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1054654222 9:67649979-67650001 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1055913824 9:81379954-81379976 CAGATTAGGGAGAAGGGAAAGGG + Intergenic
1055966833 9:81873634-81873656 GAGATTAGGGAGCAGGGGCGGGG - Intergenic
1056275036 9:84986201-84986223 CTGAATATGGAGCAGGGGTCGGG - Intronic
1056515455 9:87345191-87345213 CAAATTAGGCAGCAGTGGGAAGG + Intergenic
1057392658 9:94652596-94652618 CTGAATATGGAGCGGGGGGCGGG - Intergenic
1060346550 9:122821885-122821907 TAGATTAGGGAACAGGGAGTGGG + Intronic
1060839593 9:126783127-126783149 CAGTGTAGGGAGCAGGGTGGGGG + Intergenic
1060978904 9:127781316-127781338 CAGAAGTGAGAGCAGGGGGCTGG - Intergenic
1061396337 9:130345864-130345886 CAGGGTAGGGCGGAGGGGGCAGG + Intronic
1061405976 9:130393306-130393328 CAGGGTATGGAGCAGGGGGTGGG + Intronic
1062121723 9:134837406-134837428 CAGATTAGGGAGCAGGGGTCTGG - Intronic
1062460566 9:136660991-136661013 CAGGTGGGGGAGGAGGGGGCAGG + Intronic
1062478847 9:136742353-136742375 CAGAGTTGGGGGCCGGGGGCCGG - Intronic
1185892484 X:3833741-3833763 CAGGTTCTGGAGCAGGTGGCGGG - Intronic
1185897592 X:3872160-3872182 CAGGTTCTGGAGCAGGTGGCGGG - Intergenic
1185902711 X:3910592-3910614 CAGGTTCTGGAGCAGGTGGCGGG - Intergenic
1185970538 X:4657590-4657612 TATATTAGGGAACAGGGGCCTGG - Intergenic
1186735875 X:12463380-12463402 CAGACTAGGGAGGAGAGTGCTGG - Intronic
1187929257 X:24279085-24279107 CACTTTGGGAAGCAGGGGGCAGG - Intergenic
1189848818 X:45159128-45159150 ATCATTGGGGAGCAGGGGGCGGG + Intronic
1190217976 X:48492799-48492821 CAGAGTTTGGAGCTGGGGGCGGG + Intergenic
1190502771 X:51095883-51095905 CAGATGAGGCAGCACTGGGCAGG + Intergenic
1190598554 X:52068305-52068327 AATATTAGGCAGTAGGGGGCGGG + Intronic
1190610270 X:52185768-52185790 AATATTAGGCAGTAGGGGGCGGG - Intronic
1190771931 X:53522016-53522038 CTGGTTAGGGGGGAGGGGGCAGG + Intergenic
1190782301 X:53609745-53609767 CAGATTTGGGCACAGGGTGCAGG + Intronic
1192333629 X:70199922-70199944 CTGAGTAGGGAGCAAGGGTCTGG - Intronic
1192706041 X:73529285-73529307 CAGCTTAGGGAGGAGGGGAGAGG - Intergenic
1193655087 X:84188343-84188365 CAGCTTGGGGTGAAGGGGGCGGG + Intergenic
1195692476 X:107638673-107638695 CACTTTGGGGAGCAGGGGGCAGG - Intronic
1197645152 X:129009495-129009517 CAGATTTAGGAGAAGGGGACTGG - Intergenic
1197698775 X:129580387-129580409 CTGGTTAGGGAGAATGGGGCAGG + Intronic
1197892582 X:131281181-131281203 TAGGTTGGGGAACAGGGGGCTGG + Intronic
1198435001 X:136608697-136608719 CATATCAGGCAGCAGGTGGCAGG + Intergenic
1200137806 X:153883425-153883447 CAGAGGAGAGAGCAGGGGGGCGG + Intronic
1200256452 X:154585434-154585456 CAGATGCGGGGCCAGGGGGCCGG + Exonic
1200261317 X:154618969-154618991 CAGATGCGGGGCCAGGGGGCCGG - Exonic
1202334211 Y:23789816-23789838 CAGAGGAGAGGGCAGGGGGCGGG + Intergenic
1202536557 Y:25880243-25880265 CAGAGGAGAGGGCAGGGGGCGGG - Intergenic