ID: 1034497695

View in Genome Browser
Species Human (GRCh38)
Location 7:151432176-151432198
Sequence GCGACTGCACTCGTGCGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 51}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034497685_1034497695 30 Left 1034497685 7:151432123-151432145 CCCGGCCATCCCGGTGGGAGGGC 0: 1
1: 0
2: 1
3: 7
4: 189
Right 1034497695 7:151432176-151432198 GCGACTGCACTCGTGCGCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1034497688_1034497695 25 Left 1034497688 7:151432128-151432150 CCATCCCGGTGGGAGGGCTCGGC 0: 1
1: 0
2: 1
3: 4
4: 99
Right 1034497695 7:151432176-151432198 GCGACTGCACTCGTGCGCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1034497686_1034497695 29 Left 1034497686 7:151432124-151432146 CCGGCCATCCCGGTGGGAGGGCT 0: 1
1: 0
2: 1
3: 6
4: 122
Right 1034497695 7:151432176-151432198 GCGACTGCACTCGTGCGCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1034497691_1034497695 20 Left 1034497691 7:151432133-151432155 CCGGTGGGAGGGCTCGGCTGGAA 0: 1
1: 0
2: 1
3: 9
4: 148
Right 1034497695 7:151432176-151432198 GCGACTGCACTCGTGCGCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1034497690_1034497695 21 Left 1034497690 7:151432132-151432154 CCCGGTGGGAGGGCTCGGCTGGA 0: 1
1: 0
2: 1
3: 35
4: 232
Right 1034497695 7:151432176-151432198 GCGACTGCACTCGTGCGCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034497695 Original CRISPR GCGACTGCACTCGTGCGCTG TGG Intronic
913000544 1:114576297-114576319 GCCACTGCACTCCAGCGTTGGGG - Intronic
919761075 1:201098718-201098740 GCCACTGCCCTCCTGCTCTGGGG - Intronic
924598704 1:245469192-245469214 CCTACTGCACTCCTGCACTGTGG + Intronic
1064014964 10:11764546-11764568 GCCACTGCACTCTAGCTCTGGGG + Intergenic
1064748075 10:18497458-18497480 GCGACTGCACTCCAGCCCGGGGG - Intronic
1077268268 11:1662920-1662942 GCACCTGCATTCGTGGGCTGTGG - Intergenic
1077272613 11:1688699-1688721 GCACCTGCATTCGTGGGCTGTGG + Intergenic
1086853692 11:91841121-91841143 GCATCTGCACATGTGCGCTGGGG - Intergenic
1094039882 12:26111437-26111459 GCCACTGCACTCCAGCTCTGTGG + Intergenic
1108484011 13:50906555-50906577 GCGTCTGCATTCGTTTGCTGAGG + Intergenic
1111876708 13:93906102-93906124 CAGACTGCACTCTTGCACTGAGG - Intronic
1113861057 13:113487525-113487547 GTGGCTGGACTCGTGCACTGTGG - Intronic
1119248891 14:73135652-73135674 GCGACTGCACCCGGCCGCTTGGG + Intergenic
1119284758 14:73443946-73443968 GCCACTGCACTCCTGCGTGGGGG - Intronic
1120204465 14:81573057-81573079 GCTACTGCAATCGTGGGCTATGG - Intergenic
1122575797 14:102740861-102740883 GCCACTGCACTCTTGAGCTCAGG - Intergenic
1141065231 16:80908701-80908723 GCCACTGCACTCCTGGGCAGGGG + Intergenic
1144492696 17:15728138-15728160 GCCACTGCACTCCAGCGCGGGGG - Intergenic
1144907557 17:18648518-18648540 GCCACTGCACTCAAGCGCGGGGG + Intronic
1145254898 17:21317073-21317095 GGGGCTGCAGTCGTGCGCGGAGG - Intergenic
1146036125 17:29408264-29408286 GCCACTGCACTCCAGCCCTGGGG - Intronic
1146060003 17:29599915-29599937 GCCACTGCACTCTAGCGCGGGGG - Intronic
1153566717 18:6426244-6426266 GGGACTGAACTCGTAAGCTGTGG + Intergenic
1156817421 18:41327952-41327974 GCCACTGCACTCCAGCCCTGGGG - Intergenic
935746648 2:106194635-106194657 GCCACTGCAGTCGTGCCCTTGGG - Intergenic
1172163554 20:32885062-32885084 GCAACTGCTCTAGTGCTCTGGGG - Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
949891221 3:8734757-8734779 GCGACTGCACTCCAGCCTTGGGG - Intronic
961691606 3:128674144-128674166 GCCACTGCACTCCAGCGCGGTGG - Intronic
962750456 3:138431153-138431175 GCCACTGCACTCCAGCTCTGGGG + Intergenic
965906271 3:173710596-173710618 GACATTGCACTCGTGTGCTGTGG - Intronic
966373764 3:179274920-179274942 ACGACTCCACTCATGAGCTGTGG - Intergenic
973635876 4:52861959-52861981 GCGAGTGCGCGCGTGGGCTGTGG + Intergenic
977848203 4:101791030-101791052 ACAACTGCACTCGGGCACTGAGG + Intronic
985255559 4:188066828-188066850 GCCACTGCACTCCAGCCCTGGGG - Intergenic
993900160 5:93579593-93579615 GGGACTGCACCCGGGGGCTGGGG - Intergenic
998618797 5:143771765-143771787 GCTACTCCACTCATGCTCTGGGG + Intergenic
998899566 5:146838528-146838550 GCCACTGCACTCCTGCCCAGAGG + Intronic
1000041308 5:157487144-157487166 GAGAGTGTACTCGTGTGCTGAGG - Intronic
1006385416 6:33728122-33728144 GCGACTGCACCCTTGCCCAGTGG - Exonic
1018969635 6:168517535-168517557 GCGACAGCTCTCGGGCTCTGAGG + Intronic
1026788452 7:73316778-73316800 GTGACTGCAGTCCTGCACTGTGG - Intronic
1032019308 7:128398179-128398201 GCCACTGCACTCCAGCCCTGGGG - Intronic
1033144997 7:138863702-138863724 GCGACTGCCCTCGTGGGATGGGG + Intronic
1034497695 7:151432176-151432198 GCGACTGCACTCGTGCGCTGTGG + Intronic
1034835815 7:154350924-154350946 GAAATTGCACTCCTGCGCTGAGG + Intronic
1038401506 8:27287885-27287907 GCGCCAGGACTCGGGCGCTGAGG - Exonic
1046325971 8:112647340-112647362 GCCACTGCACTCCAGCCCTGGGG - Intronic
1049934097 9:484104-484126 GCTTCTGCACTTGTGAGCTGAGG + Intronic
1194600287 X:95912869-95912891 GCCACTGCACTCCAGCTCTGGGG - Intergenic
1197445832 X:126551949-126551971 GCGACGGCACTGTGGCGCTGTGG - Exonic