ID: 1034497730

View in Genome Browser
Species Human (GRCh38)
Location 7:151432318-151432340
Sequence CGGAGTCCCGGGGGACTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034497730_1034497744 30 Left 1034497730 7:151432318-151432340 CCAGGAAGTCCCCCGGGACTCCG 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1034497744 7:151432371-151432393 AGCAACCCCTCCCGGTCGAGCGG No data
1034497730_1034497737 1 Left 1034497730 7:151432318-151432340 CCAGGAAGTCCCCCGGGACTCCG 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1034497737 7:151432342-151432364 AGAGAAAAGCCTGCACAGCCTGG No data
1034497730_1034497740 22 Left 1034497730 7:151432318-151432340 CCAGGAAGTCCCCCGGGACTCCG 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1034497740 7:151432363-151432385 GGCCACCCAGCAACCCCTCCCGG 0: 1
1: 0
2: 1
3: 28
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034497730 Original CRISPR CGGAGTCCCGGGGGACTTCC TGG (reversed) Intronic
900337808 1:2173366-2173388 CAGGGACCAGGGGGACTTCCGGG + Intronic
902463083 1:16594177-16594199 CAGAGTTCCAGGGGAATTCCAGG - Intronic
902779806 1:18697734-18697756 CAGAATCCAGGAGGACTTCCTGG - Intronic
903158435 1:21466552-21466574 CAGAGTTCCAGGGGAATTCCAGG + Intronic
903461664 1:23524981-23525003 CCCAGACCCAGGGGACTTCCTGG + Intronic
903860107 1:26360013-26360035 CGGAGGCCCGGGGGCCTGCCTGG - Intergenic
904353845 1:29925937-29925959 GGGACTACCAGGGGACTTCCTGG - Intergenic
905907149 1:41626729-41626751 CGGCATCCTGGGGCACTTCCTGG - Intronic
906790097 1:48651710-48651732 CTGAGTCCAGAGGGGCTTCCTGG - Intronic
916028444 1:160855676-160855698 CAGGGGCCCGGGGGCCTTCCTGG - Intronic
920665306 1:207959147-207959169 AGGAGTCCCGGGGCTCTGCCGGG - Intergenic
921217609 1:212950867-212950889 CGGGGTCCGGGAGGGCTTCCTGG + Intronic
921392800 1:214633921-214633943 TGGAGTCGCGGGAGAGTTCCTGG - Intronic
922159442 1:223067958-223067980 GGGAGTCTAGGGGGACCTCCGGG - Intergenic
922753798 1:228083061-228083083 CGGCGTCCAAGCGGACTTCCGGG - Intronic
924263010 1:242251504-242251526 CAAAGTCCCGGAGGACTTCCAGG - Intronic
924510977 1:244729063-244729085 TGGAGTCCCTGGCGCCTTCCAGG - Intergenic
1065814175 10:29469770-29469792 CGGACTCTCCGGGCACTTCCCGG - Intronic
1066721772 10:38346945-38346967 CAAAGTCCCAGAGGACTTCCAGG + Intergenic
1070238574 10:74655653-74655675 GGGAGGCCCGGGGGTCTTCCTGG - Intronic
1075940460 10:126387200-126387222 CGGAGACCCGGGGAAGTTGCCGG + Intronic
1077001994 11:328126-328148 CGGAGTCCTGGGGGACTTGCGGG - Intergenic
1077278510 11:1729910-1729932 AGGAGCCCCCGGGGGCTTCCAGG + Intergenic
1077504280 11:2922876-2922898 TGGAGGCCCCGGGGACTTCTGGG + Intronic
1077549932 11:3195707-3195729 CAGAGTCCCGGGGCAGGTCCAGG - Intergenic
1080639157 11:34148779-34148801 CGGAGTCCTCCGGGACTTCCGGG - Intergenic
1084381527 11:68816007-68816029 CGTGGTTCCGGGGGACGTCCAGG - Intronic
1084561989 11:69910441-69910463 CGTGGGCCCGTGGGACTTCCTGG - Intergenic
1087400984 11:97667120-97667142 CGCAGGCCAGGGGGAGTTCCAGG + Intergenic
1088989616 11:114940856-114940878 CGGGGTCACGGGGGCCTTCAGGG + Intergenic
1089655891 11:119946698-119946720 AGGAGTCCAGGAGGACTTCCAGG + Intergenic
1103994477 12:124820373-124820395 AGGAGTCCGGGAGGTCTTCCTGG + Intronic
1104833170 12:131768707-131768729 CGGCGTCCCGGGGGGCTGCTGGG - Intronic
1106248795 13:27968812-27968834 CGCAGTCCCCGGGGCCATCCTGG - Exonic
1113494085 13:110714120-110714142 CCGAGTCGCCGGGGACCTCCGGG + Intronic
1114600849 14:23954319-23954341 AGGGGTTCCGGGGGACTTTCCGG - Intronic
1130217155 15:81983213-81983235 CGAAGGACCGGGGGACTTCACGG + Intergenic
1131829615 15:96345730-96345752 CGGAGACCTCGGGGACCTCCGGG + Intergenic
1134019323 16:10910575-10910597 AGGAGGTCAGGGGGACTTCCTGG + Intronic
1135205451 16:20480133-20480155 CAGGGTCCCAGGGGGCTTCCTGG + Intronic
1135213457 16:20543679-20543701 CAGGGTCCCAGGGGGCTTCCTGG - Intronic
1137402625 16:48165578-48165600 GGCAGCCCCCGGGGACTTCCTGG - Intergenic
1138245744 16:55466132-55466154 CGGAATCAAGGAGGACTTCCTGG + Intronic
1139346578 16:66307647-66307669 GGGAGTCAGGGAGGACTTCCTGG + Intergenic
1142156000 16:88533182-88533204 CGGAGGCCAGGGGGCCTTGCAGG - Exonic
1142961221 17:3553607-3553629 GGCAGTCTCAGGGGACTTCCTGG - Intronic
1151842144 17:76626350-76626372 CATAGTCCCGGGTGCCTTCCAGG + Exonic
1152609841 17:81310107-81310129 GGGAGTCCCGGGGCACAGCCGGG + Intergenic
1160595121 18:79968011-79968033 CGGAGTCTCTGAGGACATCCTGG + Intronic
1160809682 19:1008001-1008023 CGGGGTCTCTGGGGACCTCCTGG + Intronic
1161082891 19:2320230-2320252 CGGAGTCCAGGAGGATTGCCCGG + Intronic
1161335462 19:3710525-3710547 CTGAGTCCCGGGGAAAGTCCAGG + Intronic
1165459599 19:35936677-35936699 CGGCGTCCCGGCTGGCTTCCTGG - Intronic
1165696852 19:37907253-37907275 CGGTGGCCCGAGTGACTTCCAGG - Exonic
1166795767 19:45424453-45424475 CGGAGTCCGGAAGGGCTTCCTGG + Intronic
1167007044 19:46782805-46782827 GGCAGTCAGGGGGGACTTCCTGG + Intronic
1168153860 19:54462728-54462750 CGGAGCCCCCCGGGACTCCCAGG + Exonic
1202678744 1_KI270711v1_random:31610-31632 CAGAGTTCCAGGGGAATTCCAGG - Intergenic
925132506 2:1503675-1503697 CCGAGTCACAGGAGACTTCCTGG - Intronic
925432447 2:3806937-3806959 CGGAGTCCTTGGTGAATTCCTGG + Intronic
927879272 2:26679356-26679378 TGGGGTCATGGGGGACTTCCTGG + Intergenic
929461072 2:42102363-42102385 CGGAGCCCGGGGTGACTTGCGGG + Intergenic
929604908 2:43227387-43227409 CGGAGTGGCGCGGGACGTCCCGG + Intergenic
933886976 2:86727709-86727731 TGGAGACCCGTGGTACTTCCAGG + Intronic
933923202 2:87068999-87069021 TGGAGACCCGTGGTACTTCCAGG - Intergenic
937448248 2:121976457-121976479 CAGAATCCCGAGGGACTTCCAGG - Intergenic
940017692 2:149123988-149124010 AGGAGCCCGGGGGGCCTTCCTGG - Intronic
948117681 2:235505686-235505708 CGGAGTCCAGGGAGAGATCCTGG + Intronic
1174402953 20:50285733-50285755 CGGAGTCCCGGGGGACCAGGAGG - Intergenic
1176207066 20:63894986-63895008 CGGAGTCCCGAGTGACAGCCCGG - Intergenic
1178924341 21:36762383-36762405 CGGGGCCCGGGGGGACTTCATGG + Intronic
1183631700 22:39037077-39037099 AGGAGTGCTGGGGGGCTTCCAGG + Intergenic
1185146547 22:49140098-49140120 GGGCATCCAGGGGGACTTCCTGG - Intergenic
952152405 3:30607004-30607026 CGGGGCGCCGGGGGTCTTCCTGG + Intronic
954630409 3:52044928-52044950 TGCTGTCCTGGGGGACTTCCAGG + Intergenic
956291965 3:67670068-67670090 CGGAGTCCCAGGTGTATTCCTGG + Intergenic
960997227 3:123348215-123348237 CAGAGTCTCAGGGGACATCCAGG - Intronic
962277873 3:134029679-134029701 CGGAGTCCGCGGGGTCTTCCGGG - Intronic
968319161 3:197750207-197750229 CGGAGGCCCGGAGGACAGCCGGG + Intronic
973760009 4:54107032-54107054 GGGAGCCCCTGGGGCCTTCCTGG - Intronic
995073150 5:107948363-107948385 AGGAGTCCAGGGTGACTCCCAGG - Intronic
998370488 5:141657732-141657754 AGGAGTCCCAGAGGACTCCCAGG + Intronic
1000265131 5:159629013-159629035 TGGAGTCCTGGGGGACCTCAGGG + Intergenic
1001716462 5:173820306-173820328 AGAAGTCCCAGTGGACTTCCAGG + Intergenic
1002521465 5:179795186-179795208 CAGACTCCCGAGGCACTTCCTGG + Intronic
1002602186 5:180360393-180360415 GTGAATCCAGGGGGACTTCCTGG - Intergenic
1006295031 6:33166514-33166536 GGGAGGCCGGGGGGACCTCCAGG + Exonic
1006513728 6:34534792-34534814 TGGAGCTCAGGGGGACTTCCAGG - Exonic
1006718674 6:36136221-36136243 CTGTGTCCCAGGGGACTTCATGG + Intronic
1006844101 6:37050714-37050736 TGGAGTCCTGGGGGACCTCACGG + Intergenic
1010229159 6:73520276-73520298 CGGAGTACCGGGCGCCGTCCAGG - Exonic
1019719460 7:2559441-2559463 CGGCGTCCCGGAGAGCTTCCTGG - Intronic
1021378030 7:19932746-19932768 GGGAGTCCTTGAGGACTTCCTGG + Intergenic
1025035435 7:55590346-55590368 CAGAGTCCTGTGTGACTTCCTGG + Intergenic
1026972305 7:74475838-74475860 CGGGGTGACGGGGGACTTCCTGG + Intronic
1027348664 7:77288184-77288206 GGGAGTCCAGGGGGACTTCTAGG - Intronic
1029477525 7:100793887-100793909 CGCAGTCCCCGGGGTCTGCCAGG - Exonic
1029494589 7:100890075-100890097 GGGAGCCCCGGGGGACGTCGGGG + Exonic
1030067960 7:105674834-105674856 GGGAGTCCCAGGGGCTTTCCAGG + Intronic
1034497730 7:151432318-151432340 CGGAGTCCCGGGGGACTTCCTGG - Intronic
1034737214 7:153440369-153440391 GGAAGTCCGAGGGGACTTCCTGG + Intergenic
1043438757 8:80258598-80258620 GGGAGTCCCAGGAGACTGCCAGG + Intergenic
1045292738 8:100847746-100847768 AGGAGTCCGGGGAGAATTCCTGG - Intergenic
1049223860 8:141440450-141440472 CGGAGTCCGGTGGGAGTTTCAGG + Intergenic
1049480567 8:142820573-142820595 TGGAGTCACGGGAGGCTTCCTGG - Intergenic
1059398093 9:114051494-114051516 CGGAGTCGCTGTGGACTGCCAGG - Exonic
1060518599 9:124281180-124281202 CGGAGTACTGGGTGATTTCCTGG - Intronic
1060557122 9:124513719-124513741 GGGAGGCCATGGGGACTTCCGGG + Intergenic
1062106710 9:134758827-134758849 CGGTGACCTGGGGGTCTTCCTGG + Intronic
1062569945 9:137180397-137180419 CGGTGTCACGGGGGACCTGCGGG + Intronic
1187507330 X:19887933-19887955 AGGAGTCTCGCGGCACTTCCCGG - Intergenic
1192316108 X:70053088-70053110 TGGAGTCCCAGGACACTTCCAGG + Intergenic
1193109588 X:77714329-77714351 CGGAGTCCGGTGGGCCTTGCTGG - Intronic