ID: 1034498125

View in Genome Browser
Species Human (GRCh38)
Location 7:151433936-151433958
Sequence CCCGTGTCCTGGTGGGCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034498125_1034498136 2 Left 1034498125 7:151433936-151433958 CCGAGAGCCCACCAGGACACGGG No data
Right 1034498136 7:151433961-151433983 TGAGGGGATGGGTCATGCCTGGG No data
1034498125_1034498138 12 Left 1034498125 7:151433936-151433958 CCGAGAGCCCACCAGGACACGGG No data
Right 1034498138 7:151433971-151433993 GGTCATGCCTGGGCTGATGTGGG No data
1034498125_1034498135 1 Left 1034498125 7:151433936-151433958 CCGAGAGCCCACCAGGACACGGG No data
Right 1034498135 7:151433960-151433982 CTGAGGGGATGGGTCATGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 249
1034498125_1034498134 -9 Left 1034498125 7:151433936-151433958 CCGAGAGCCCACCAGGACACGGG No data
Right 1034498134 7:151433950-151433972 GGACACGGGTCTGAGGGGATGGG No data
1034498125_1034498140 21 Left 1034498125 7:151433936-151433958 CCGAGAGCCCACCAGGACACGGG No data
Right 1034498140 7:151433980-151434002 TGGGCTGATGTGGGACCCAGAGG 0: 1
1: 0
2: 1
3: 25
4: 294
1034498125_1034498133 -10 Left 1034498125 7:151433936-151433958 CCGAGAGCCCACCAGGACACGGG No data
Right 1034498133 7:151433949-151433971 AGGACACGGGTCTGAGGGGATGG No data
1034498125_1034498142 26 Left 1034498125 7:151433936-151433958 CCGAGAGCCCACCAGGACACGGG No data
Right 1034498142 7:151433985-151434007 TGATGTGGGACCCAGAGGGAAGG 0: 1
1: 0
2: 0
3: 43
4: 336
1034498125_1034498137 11 Left 1034498125 7:151433936-151433958 CCGAGAGCCCACCAGGACACGGG No data
Right 1034498137 7:151433970-151433992 GGGTCATGCCTGGGCTGATGTGG 0: 1
1: 0
2: 3
3: 11
4: 224
1034498125_1034498141 22 Left 1034498125 7:151433936-151433958 CCGAGAGCCCACCAGGACACGGG No data
Right 1034498141 7:151433981-151434003 GGGCTGATGTGGGACCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034498125 Original CRISPR CCCGTGTCCTGGTGGGCTCT CGG (reversed) Intronic