ID: 1034498125

View in Genome Browser
Species Human (GRCh38)
Location 7:151433936-151433958
Sequence CCCGTGTCCTGGTGGGCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 177}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034498125_1034498133 -10 Left 1034498125 7:151433936-151433958 CCGAGAGCCCACCAGGACACGGG 0: 1
1: 1
2: 1
3: 14
4: 177
Right 1034498133 7:151433949-151433971 AGGACACGGGTCTGAGGGGATGG No data
1034498125_1034498141 22 Left 1034498125 7:151433936-151433958 CCGAGAGCCCACCAGGACACGGG 0: 1
1: 1
2: 1
3: 14
4: 177
Right 1034498141 7:151433981-151434003 GGGCTGATGTGGGACCCAGAGGG No data
1034498125_1034498140 21 Left 1034498125 7:151433936-151433958 CCGAGAGCCCACCAGGACACGGG 0: 1
1: 1
2: 1
3: 14
4: 177
Right 1034498140 7:151433980-151434002 TGGGCTGATGTGGGACCCAGAGG 0: 1
1: 0
2: 1
3: 25
4: 294
1034498125_1034498142 26 Left 1034498125 7:151433936-151433958 CCGAGAGCCCACCAGGACACGGG 0: 1
1: 1
2: 1
3: 14
4: 177
Right 1034498142 7:151433985-151434007 TGATGTGGGACCCAGAGGGAAGG 0: 1
1: 0
2: 0
3: 43
4: 336
1034498125_1034498137 11 Left 1034498125 7:151433936-151433958 CCGAGAGCCCACCAGGACACGGG 0: 1
1: 1
2: 1
3: 14
4: 177
Right 1034498137 7:151433970-151433992 GGGTCATGCCTGGGCTGATGTGG 0: 1
1: 0
2: 3
3: 11
4: 224
1034498125_1034498134 -9 Left 1034498125 7:151433936-151433958 CCGAGAGCCCACCAGGACACGGG 0: 1
1: 1
2: 1
3: 14
4: 177
Right 1034498134 7:151433950-151433972 GGACACGGGTCTGAGGGGATGGG No data
1034498125_1034498138 12 Left 1034498125 7:151433936-151433958 CCGAGAGCCCACCAGGACACGGG 0: 1
1: 1
2: 1
3: 14
4: 177
Right 1034498138 7:151433971-151433993 GGTCATGCCTGGGCTGATGTGGG No data
1034498125_1034498135 1 Left 1034498125 7:151433936-151433958 CCGAGAGCCCACCAGGACACGGG 0: 1
1: 1
2: 1
3: 14
4: 177
Right 1034498135 7:151433960-151433982 CTGAGGGGATGGGTCATGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 249
1034498125_1034498136 2 Left 1034498125 7:151433936-151433958 CCGAGAGCCCACCAGGACACGGG 0: 1
1: 1
2: 1
3: 14
4: 177
Right 1034498136 7:151433961-151433983 TGAGGGGATGGGTCATGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034498125 Original CRISPR CCCGTGTCCTGGTGGGCTCT CGG (reversed) Intronic
901088831 1:6628228-6628250 CCCGGCTCCTGGTAGGCTCCTGG + Intronic
902118258 1:14139685-14139707 CCCATGCCCTGCTGGGCACTGGG - Intergenic
902513017 1:16976387-16976409 CCCTTGCCCATGTGGGCTCTTGG - Intronic
902948975 1:19866085-19866107 CCTTTTTCCTGGGGGGCTCTGGG - Intergenic
903259432 1:22123301-22123323 CCTGTGTACTGGTGGTCCCTGGG + Intronic
906292810 1:44631113-44631135 CCAGTGCCATGCTGGGCTCTGGG + Intronic
908302822 1:62779111-62779133 CAGGTGTGCTGGTGGGCGCTTGG - Intergenic
908610569 1:65855546-65855568 CCCATTTCTGGGTGGGCTCTAGG + Intronic
912500692 1:110120159-110120181 CCCATTTCCTGGTGCCCTCTGGG + Intergenic
918121547 1:181545453-181545475 CCTGTGTCCTGCAGGGCTGTGGG + Intronic
921498294 1:215868056-215868078 CCTGTGTCCTGGATGCCTCTGGG - Intronic
1067054392 10:43042593-43042615 CCCATCTCCCAGTGGGCTCTGGG + Intergenic
1068502523 10:57858120-57858142 CATGTGTCCTGGTAGGTTCTTGG - Intergenic
1069782228 10:70964230-70964252 CCCGGGCCCTGGTGGGACCTTGG - Intergenic
1071526792 10:86363902-86363924 GCCGTGTCCCAGTGGGCCCTGGG + Intronic
1077031443 11:469742-469764 CCCGTGGACTGGAGGGCACTAGG - Intronic
1077212078 11:1375717-1375739 TCCGGGTCCTGCTGGGTTCTTGG + Intergenic
1077323542 11:1953407-1953429 TACGTATCCTGGGGGGCTCTGGG + Intronic
1078137393 11:8662594-8662616 CTAGTGTCCAGGTGAGCTCTAGG + Intronic
1079005557 11:16789167-16789189 CCAGTGTCCTCTTGCGCTCTCGG + Exonic
1081578166 11:44332635-44332657 CCCATGTTCTGGTGGGCACATGG - Intergenic
1081779745 11:45701955-45701977 CTAGTGTCATGGTAGGCTCTGGG - Intergenic
1084328031 11:68412989-68413011 CCCGTGTCCTGGTTGTCGCTGGG + Intronic
1084414164 11:69021205-69021227 CCTCTGTGCTGGTGGGCTCAGGG + Intergenic
1084666851 11:70580950-70580972 CCCTGGACCTGGTGGGCTCCAGG - Intronic
1084899580 11:72299670-72299692 CCCCTGACTTTGTGGGCTCTGGG + Intronic
1085637407 11:78169221-78169243 CCTGTGTCCCAGGGGGCTCTGGG - Intergenic
1089282020 11:117381379-117381401 CCCCAGTGCTGGTGAGCTCTGGG + Intronic
1089535702 11:119159784-119159806 CCTTTGGCCTGGTTGGCTCTTGG + Intronic
1202806529 11_KI270721v1_random:8602-8624 TACGTATCCTGGGGGGCTCTGGG + Intergenic
1091828935 12:3535574-3535596 GCCTTGTCCTGTTGGGTTCTTGG - Intronic
1092290409 12:7156880-7156902 CCCTTCTCCTGGTGGGCTTGGGG - Intronic
1096173977 12:49499354-49499376 TCCCTGGCCTGGTGAGCTCTGGG + Intronic
1101545234 12:105706249-105706271 CCCTTGTCCTGGAGAACTCTTGG - Intergenic
1102387101 12:112519304-112519326 CCGGTGGGCTGGTGGGCTCGTGG + Intergenic
1102415815 12:112761688-112761710 CGGGTGTCCTTGTGGGCTCAGGG - Intronic
1103475921 12:121218591-121218613 GCCTTGTCCCGGTGAGCTCTGGG + Intronic
1104735223 12:131132278-131132300 GCAGTGTCCTGGTGTGCTCTGGG + Intronic
1104999485 12:132680484-132680506 CCCGAGTTCTGCTGGGCTATGGG + Intronic
1107793103 13:44022546-44022568 CCTGTGCCCTGCTGGGCTCTGGG - Intergenic
1108683966 13:52803077-52803099 GCCCTATCCTGGTGGGATCTGGG + Intergenic
1113584603 13:111456525-111456547 CCTCCTTCCTGGTGGGCTCTGGG + Intergenic
1114851999 14:26392816-26392838 CCAGTGTTCTTGTTGGCTCTGGG + Intergenic
1121519830 14:94578376-94578398 CCCATGCCCTGCTAGGCTCTAGG + Intronic
1121797321 14:96745926-96745948 CCAGTGTCAGGTTGGGCTCTTGG + Intergenic
1122354048 14:101112838-101112860 TCCCTGCCTTGGTGGGCTCTGGG + Intergenic
1122588687 14:102829593-102829615 CGCATGTGCTGGTGGGCTCCTGG + Intronic
1122817024 14:104318944-104318966 CCCGTGTGCTGGTGGGGTGAGGG - Intergenic
1122935907 14:104956103-104956125 CCTGTGTCCTGCAGAGCTCTTGG + Intronic
1127365347 15:58284314-58284336 CCTGTGGCCTGCTGGGCTGTAGG - Intronic
1127959593 15:63880904-63880926 GCCTTGACCTCGTGGGCTCTTGG + Intergenic
1128237927 15:66080143-66080165 CCTGAGTCCTGGGGGGCTGTGGG - Intronic
1128513287 15:68326733-68326755 CCCTCGTCCAGGTGGGCCCTCGG + Exonic
1128524348 15:68402451-68402473 CCCCTGCTCTGGAGGGCTCTTGG + Intronic
1131195648 15:90352532-90352554 CCCGGGTCTTGCTGGGCTGTGGG + Intronic
1132379629 15:101357745-101357767 CCAGTGCCTTGGTGAGCTCTGGG + Intronic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1132831964 16:1932849-1932871 CCAGTGTCTTCGTTGGCTCTCGG - Intergenic
1133062088 16:3181689-3181711 CCCCAGTCCTGGTGGGCGCTGGG + Intergenic
1133063531 16:3190314-3190336 CCCCAGTCCTGGTGGGCGCTGGG - Intergenic
1133328764 16:4958314-4958336 CCCGGGTCCTGGAGCTCTCTCGG + Exonic
1136267133 16:29128367-29128389 ACCGGGGCCTGGTGGTCTCTTGG + Intergenic
1137716191 16:50599764-50599786 CCCGTGCCCTGCCTGGCTCTGGG + Intronic
1137748567 16:50841665-50841687 CCCGTGTCCTGCAGGGCTGAGGG - Intergenic
1138605878 16:58088397-58088419 TCCATGTCCAGGTGGGCCCTGGG - Intergenic
1139752922 16:69120071-69120093 CCCAAGGCCTGGTGGCCTCTTGG - Exonic
1141425203 16:83940372-83940394 TCCTTGTCCTGCTGGGCTCTGGG + Intronic
1141694371 16:85612784-85612806 TCCGTGTCCTGGAGGCCTTTTGG - Intronic
1142070425 16:88088690-88088712 ACCGGGGCCTGGTGGTCTCTTGG + Intronic
1142141031 16:88472980-88473002 CCCTCGTCCTGGTGGGGTCCAGG - Intronic
1142267736 16:89072261-89072283 CCCAGGTCCTGCTGGGCCCTTGG - Intergenic
1142360822 16:89625909-89625931 CCCGTGTCCTGGTAGGCTGTGGG - Intronic
1142427709 16:90009473-90009495 CCCGCGTCCTGGGGGGATGTGGG - Intronic
1142611668 17:1111823-1111845 CTGGTGTCTTGCTGGGCTCTAGG + Intronic
1143091231 17:4450119-4450141 ACCCTGTCCTGGTGGGTCCTGGG + Intronic
1144914708 17:18714373-18714395 ACAGTGTCCTGGTGGGATCCTGG + Intronic
1145868388 17:28255271-28255293 CCCCTGTCCTGCTGCTCTCTGGG - Intergenic
1148232031 17:45942338-45942360 ACCGTGTCCTGGTGCACCCTGGG - Intronic
1149302835 17:55320587-55320609 CCCGTGCCCTGGCTGGCACTGGG + Intronic
1150121686 17:62608700-62608722 CCCGTGTCATGGTAGGGTCCTGG - Intronic
1150978000 17:70110402-70110424 CCAGTCTCCTCGTAGGCTCTAGG - Intronic
1152153341 17:78616623-78616645 CTCGTGTACGGATGGGCTCTGGG - Intergenic
1152638259 17:81438985-81439007 CCCGTGTCCTGGTGGACAGAGGG + Intronic
1153765848 18:8374332-8374354 TCCATGTCCTGGTGGGTTTTTGG - Intronic
1155158524 18:23177669-23177691 GTCCTGTCCTGTTGGGCTCTGGG + Intronic
1155787213 18:29915603-29915625 CACATGTCCTCTTGGGCTCTTGG + Intergenic
1160583663 18:79901266-79901288 CCCTGGTCCTGGAGGGCTCTGGG - Intergenic
1160707901 19:538247-538269 CTCTTGGCCTGGTGAGCTCTGGG + Intronic
1160720369 19:594547-594569 CGCCTGTCCTGGTGGGGTCTTGG - Intronic
1160751330 19:735869-735891 CCTGTGTCTGGGTGGGGTCTGGG + Intronic
1161156681 19:2735468-2735490 CCCGTGTCCTGGCTGGCTGTTGG + Intronic
1161596444 19:5153367-5153389 CCCATCCCCTGGTGGGCTCCTGG + Exonic
1162756754 19:12865376-12865398 CCAGTGGACTGGTGGGCTATGGG + Exonic
1162799122 19:13101350-13101372 CCCGTGTCCTGGAAGTTTCTGGG - Intronic
1162955832 19:14097449-14097471 GCCGTGGACTGGTGGGCCCTGGG - Exonic
1163288382 19:16363544-16363566 CAGGTGTCCTTGTGGGCTCCGGG + Intronic
1163415625 19:17184810-17184832 CCCGTGCCCGTGTGGGCTGTGGG + Intronic
1163836785 19:19579791-19579813 CCCATACCCTGATGGGCTCTGGG - Intronic
1166920666 19:46227007-46227029 CCCGTGTCCTGCTTGGATCCAGG + Intergenic
925174478 2:1772444-1772466 CCCTCGTTCTGGTGTGCTCTGGG - Intergenic
925899995 2:8502478-8502500 CCCATGACCTGGCGGGCACTGGG - Intergenic
926375335 2:12222036-12222058 CCCTAGTCCTGTGGGGCTCTTGG - Intergenic
927185516 2:20479384-20479406 CCAGTGTCCTGCTGGGATCAAGG - Intergenic
929917841 2:46151068-46151090 TCCGTGGACTGGTGGGCCCTGGG + Exonic
932298219 2:70644307-70644329 TCCATGTCCTGCTGGGTTCTAGG + Intronic
934653971 2:96107867-96107889 CCTGTGTCCTGGTGAAATCTAGG - Intergenic
937003519 2:118490248-118490270 CACGTTTCCTGGTGGGTCCTGGG - Intergenic
939258624 2:139778087-139778109 GCCGTATTCTGGAGGGCTCTGGG + Intergenic
942929557 2:181473173-181473195 CCCGTGGCCTGGTAGGAACTGGG + Intronic
946003141 2:216499483-216499505 GCCGTGTGCTGGTGGGCAGTTGG + Intronic
946893858 2:224303151-224303173 CCCGTGTCCTGCTGGGCTAAAGG + Intergenic
946965278 2:225030579-225030601 CCCCTGTCCTCGTGGGCGCCTGG - Intronic
947857367 2:233333263-233333285 CCTGTGCCCTGGAGGGGTCTTGG + Intronic
948202950 2:236142910-236142932 GCAGTGTCCTGGTGTGCCCTGGG + Intergenic
948606758 2:239140834-239140856 CCTGCGTCCTCGTGGGCTCCAGG - Intronic
949060423 2:241953493-241953515 CCCCTGTCTTGGTGGACGCTCGG + Intergenic
1170548666 20:17456603-17456625 CACGTGTGCTGGTGGGCACATGG - Intronic
1171230387 20:23479564-23479586 CCCTTGTCCTGGTGGAGGCTTGG + Intergenic
1172098716 20:32473334-32473356 CACGTGCTCTGGGGGGCTCTGGG - Intronic
1173924637 20:46771637-46771659 ACAGAGTCCTGGTGGCCTCTGGG - Intergenic
1174679003 20:52386335-52386357 CCCGTGGCCTGTTGGGAACTGGG + Intergenic
1175247302 20:57589828-57589850 CCCCTGGCCTGCTGGGCTCCTGG + Intergenic
1175641407 20:60633585-60633607 CCCATGCCCTGCTGGCCTCTGGG - Intergenic
1176001066 20:62831414-62831436 GCCGTGTCCTGGAGGCTTCTCGG - Intronic
1176189071 20:63798927-63798949 CCAGTGGCCAGGAGGGCTCTGGG + Intronic
1176200666 20:63858862-63858884 CCCGTGGGCTGGTGGGATCAGGG + Intergenic
1176377161 21:6092413-6092435 CCCGGGGCCATGTGGGCTCTTGG + Intergenic
1179730468 21:43364638-43364660 CCCCAGTGCTGGTGGGCTCTAGG + Intergenic
1179746314 21:43445831-43445853 CCCGGGGCCATGTGGGCTCTTGG - Intergenic
1180355809 22:11838559-11838581 GCCGTGACCTCCTGGGCTCTGGG - Intergenic
1181688361 22:24544244-24544266 CCGGTCTCCTGCTTGGCTCTAGG - Intronic
1181766336 22:25094812-25094834 CCTGTGTCCTGGGTGGATCTGGG + Intronic
1182456584 22:30455639-30455661 CCAGTGTGGTGGTGGGTTCTTGG + Intronic
1182645766 22:31808144-31808166 CCAGTGTAGTGGTGGGATCTCGG + Intronic
1183427747 22:37748502-37748524 CCCCTGCCCTGGTGGACTGTAGG - Intronic
1184533562 22:45071650-45071672 CCCTTGTCCTGGTGGGCTGGGGG + Intergenic
950095043 3:10324171-10324193 CCCGGGCTCTGGGGGGCTCTGGG - Exonic
950118784 3:10468167-10468189 CCAGTGTCCATGTGGGCTGTGGG + Intronic
954133192 3:48570334-48570356 CCGGTGTCCTGTTGGTCTCCAGG - Exonic
954618233 3:51981206-51981228 TCCGTTTCCTGGTGTGCTGTGGG + Intronic
960118945 3:113927270-113927292 CCCCTACCCTGGTTGGCTCTTGG + Intronic
960987904 3:123292445-123292467 CCCATGGCCTGGTGGCCTCCTGG + Intronic
961675210 3:128560841-128560863 TCTCTGTCCTGGGGGGCTCTGGG - Intergenic
966854395 3:184184228-184184250 CCCTTATCCTTGTGGGTTCTGGG + Intronic
969458363 4:7313943-7313965 CCTGTGGCATGGTGGGCTCTGGG - Intronic
969790251 4:9489452-9489474 TCTGTGTCCTGGGGGGCTCAAGG - Intergenic
975537112 4:75462516-75462538 CCCGGGTCCTGTTGGGGTATGGG - Intergenic
978876189 4:113642780-113642802 CCCTTGCCCTGGTGGGCAGTTGG - Intronic
986020144 5:3794273-3794295 ACAGAGTCCTGGGGGGCTCTAGG - Intergenic
1002452390 5:179326302-179326324 GCCATGTCCTGAGGGGCTCTCGG + Intronic
1007242428 6:40436654-40436676 CCTGTGACCTGGTGGGGCCTGGG - Intronic
1008259042 6:49342571-49342593 CCCGTGTCATGGCGGCCTCCAGG + Intergenic
1011610464 6:89146047-89146069 CCGGGGTCCTGGAGGCCTCTGGG + Exonic
1015568535 6:134598672-134598694 CTAGTGTCCTGGTGGCCTGTGGG + Intergenic
1017132404 6:151118926-151118948 TCCGTGTCCTCTTGGACTCTTGG - Intergenic
1018056520 6:160056797-160056819 GTGGTATCCTGGTGGGCTCTGGG + Intronic
1019324484 7:431599-431621 CCTGGGTCCTGGGGGCCTCTGGG + Intergenic
1023819760 7:43974062-43974084 CTCCTGTCCTGGTGGGCCCAGGG + Intergenic
1026837242 7:73647322-73647344 ACCCTGTCCAGGTGGGCCCTGGG - Intergenic
1029748033 7:102527515-102527537 CTCCTGTCCTGGTGGGCCCAGGG + Intergenic
1030230330 7:107201952-107201974 CCCATGTTCTGGTAGCCTCTTGG - Exonic
1033366938 7:140678915-140678937 CAGGTGCCCTGGTGGGCTTTGGG - Intronic
1034493572 7:151407384-151407406 CCGGTAGCCTGGTGGGCACTTGG - Intronic
1034498125 7:151433936-151433958 CCCGTGTCCTGGTGGGCTCTCGG - Intronic
1034539290 7:151745891-151745913 CTCTTGGCCTGGTGTGCTCTTGG - Intronic
1035464050 7:159063825-159063847 CGGGGGTCCTGGTGGGGTCTGGG + Intronic
1035464069 7:159063863-159063885 CGGGGGTCCTGGTGGGGTCTGGG + Intronic
1036789318 8:11707914-11707936 CGGGTGTCCTGGAGGCCTCTCGG + Exonic
1040734416 8:50488708-50488730 CAAGTGTCATGCTGGGCTCTTGG - Intronic
1049423403 8:142526673-142526695 CCCGGGGCTGGGTGGGCTCTGGG - Intronic
1049803750 8:144529861-144529883 CCCGGGGCCTGGCAGGCTCTCGG - Exonic
1053010116 9:34628126-34628148 CCCCTGTGTTGGGGGGCTCTGGG - Intergenic
1054762181 9:69013416-69013438 GCCGTGGACTGGTGGGCCCTAGG - Exonic
1056258519 9:84824690-84824712 TCTGTGTCCTGGTGAGTTCTGGG + Intronic
1059642115 9:116227511-116227533 CCAGTGTCCTGATGGGCTGCAGG - Exonic
1061154164 9:128847071-128847093 CCCCTGTCCTGGAGGGGCCTTGG + Intronic
1061477884 9:130881098-130881120 CCCGTGTCCTGGTGGTCTCTGGG + Intronic
1061502829 9:131013555-131013577 CCCCTGTCCTGAGGGGCTCAGGG + Intronic
1061723781 9:132570298-132570320 CCTGGGTCCAGGTGGGCACTGGG + Intronic
1062146058 9:134990414-134990436 CGCTTCTCCCGGTGGGCTCTTGG + Intergenic
1185868281 X:3641879-3641901 GCCGTGGACTGGTGGGCCCTCGG - Exonic
1188834832 X:34943467-34943489 CCCGAGTCTTGGGAGGCTCTGGG - Exonic
1188834841 X:34943503-34943525 CCCGAGTCTTGGGAGGCTCTGGG - Exonic
1189007372 X:37009763-37009785 CCCGAGTCTTGGGAGGCTCTGGG - Exonic
1189007402 X:37009907-37009929 CGCGTGTCTTGGGGGGCTCTGGG - Exonic
1189007455 X:37010159-37010181 CCCGAGTCTTGGGAGGCTCTGGG - Exonic
1189007507 X:37010375-37010397 CCCGAGTCTTGGGAGGCTCTGGG - Exonic
1189007543 X:37010519-37010541 CCCGAGTCTTGGGAGGCTCTGGG - Exonic
1189040969 X:37542224-37542246 CCCGAGTCTTGGGAGGCTCTGGG + Intronic
1197263933 X:124346625-124346647 TCCATGGCCTGGTGGACTCTTGG - Exonic
1199599248 X:149531977-149531999 GGCTTGCCCTGGTGGGCTCTTGG - Intronic
1199600428 X:149538464-149538486 GCCTTGTCCTGGTGCGCTCCTGG - Intergenic
1199650160 X:149941477-149941499 GCCTTGTCCTGGTGCGCTCCTGG + Intergenic
1200795921 Y:7341185-7341207 GCCGTGGACTGGTGGGCCCTCGG + Intergenic