ID: 1034499759

View in Genome Browser
Species Human (GRCh38)
Location 7:151441987-151442009
Sequence CAAATGTACCACTCTAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034499759_1034499767 16 Left 1034499759 7:151441987-151442009 CCCCCATTAGAGTGGTACATTTG No data
Right 1034499767 7:151442026-151442048 TATGTTATACATCGGGATACAGG No data
1034499759_1034499764 8 Left 1034499759 7:151441987-151442009 CCCCCATTAGAGTGGTACATTTG No data
Right 1034499764 7:151442018-151442040 GATGAACCTATGTTATACATCGG No data
1034499759_1034499765 9 Left 1034499759 7:151441987-151442009 CCCCCATTAGAGTGGTACATTTG No data
Right 1034499765 7:151442019-151442041 ATGAACCTATGTTATACATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034499759 Original CRISPR CAAATGTACCACTCTAATGG GGG (reversed) Intergenic
No off target data available for this crispr