ID: 1034501217

View in Genome Browser
Species Human (GRCh38)
Location 7:151452183-151452205
Sequence CAGCTCAGGCGGCCCGGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034501210_1034501217 9 Left 1034501210 7:151452151-151452173 CCAGGTGAGCGTGGGGTGCTCCT No data
Right 1034501217 7:151452183-151452205 CAGCTCAGGCGGCCCGGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034501217 Original CRISPR CAGCTCAGGCGGCCCGGCAC CGG Intergenic
No off target data available for this crispr