ID: 1034501852

View in Genome Browser
Species Human (GRCh38)
Location 7:151455826-151455848
Sequence CAGTGTACCCCACGGCAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034501844_1034501852 18 Left 1034501844 7:151455785-151455807 CCTCAGGAAGCTCCCAATCATGG No data
Right 1034501852 7:151455826-151455848 CAGTGTACCCCACGGCAAGTGGG No data
1034501847_1034501852 5 Left 1034501847 7:151455798-151455820 CCAATCATGGTGCAAGATGAAGG No data
Right 1034501852 7:151455826-151455848 CAGTGTACCCCACGGCAAGTGGG No data
1034501846_1034501852 6 Left 1034501846 7:151455797-151455819 CCCAATCATGGTGCAAGATGAAG No data
Right 1034501852 7:151455826-151455848 CAGTGTACCCCACGGCAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034501852 Original CRISPR CAGTGTACCCCACGGCAAGT GGG Intergenic
No off target data available for this crispr