ID: 1034503165

View in Genome Browser
Species Human (GRCh38)
Location 7:151464825-151464847
Sequence GTGTACACACAGGATTAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034503160_1034503165 6 Left 1034503160 7:151464796-151464818 CCCAGGTCACCGTATTGATGCCG No data
Right 1034503165 7:151464825-151464847 GTGTACACACAGGATTAGCACGG No data
1034503161_1034503165 5 Left 1034503161 7:151464797-151464819 CCAGGTCACCGTATTGATGCCGA No data
Right 1034503165 7:151464825-151464847 GTGTACACACAGGATTAGCACGG No data
1034503159_1034503165 13 Left 1034503159 7:151464789-151464811 CCTAGCTCCCAGGTCACCGTATT No data
Right 1034503165 7:151464825-151464847 GTGTACACACAGGATTAGCACGG No data
1034503162_1034503165 -3 Left 1034503162 7:151464805-151464827 CCGTATTGATGCCGAACTCAGTG No data
Right 1034503165 7:151464825-151464847 GTGTACACACAGGATTAGCACGG No data
1034503156_1034503165 23 Left 1034503156 7:151464779-151464801 CCTGGCGGTCCCTAGCTCCCAGG No data
Right 1034503165 7:151464825-151464847 GTGTACACACAGGATTAGCACGG No data
1034503158_1034503165 14 Left 1034503158 7:151464788-151464810 CCCTAGCTCCCAGGTCACCGTAT No data
Right 1034503165 7:151464825-151464847 GTGTACACACAGGATTAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034503165 Original CRISPR GTGTACACACAGGATTAGCA CGG Intergenic
No off target data available for this crispr