ID: 1034504518

View in Genome Browser
Species Human (GRCh38)
Location 7:151476819-151476841
Sequence TTCATGTCTCCTCTTATCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034504518_1034504525 26 Left 1034504518 7:151476819-151476841 CCCCCGATAAGAGGAGACATGAA 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1034504525 7:151476868-151476890 ATTCTTATTAATAAAAATAGTGG 0: 1
1: 1
2: 6
3: 103
4: 1108
1034504518_1034504522 -8 Left 1034504518 7:151476819-151476841 CCCCCGATAAGAGGAGACATGAA 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1034504522 7:151476834-151476856 GACATGAAATACGTAGCTAGAGG 0: 1
1: 0
2: 0
3: 2
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034504518 Original CRISPR TTCATGTCTCCTCTTATCGG GGG (reversed) Intronic
900770995 1:4544245-4544267 TGCATGTCTTCTCTTCTTGGAGG - Intergenic
902599796 1:17533058-17533080 TTCATCTCTCCTCTCATCACAGG + Intergenic
906448854 1:45926656-45926678 TTCATTTCTCCTCTTACAGCAGG + Intronic
908344802 1:63221180-63221202 TTCATGTTCCCTCTTATATGAGG + Intergenic
911459697 1:98173920-98173942 TTCTTTTCTCCTCTTATTGAAGG + Intergenic
912851684 1:113131251-113131273 TTCTTGTTTCTTCTTATCTGTGG + Exonic
924204502 1:241697937-241697959 TTCATGCCTTCTCTTAATGGTGG + Intronic
924295057 1:242578067-242578089 CTCATGTCTCCTCTTATAAGGGG + Intergenic
1068462706 10:57348428-57348450 TTCTTGTCTTCTCCTATCGTTGG + Intergenic
1071003567 10:80857982-80858004 TCCATGTCTTCTCTTACTGGAGG + Intergenic
1080354775 11:31430704-31430726 AGCATGTCTCCTCTTTTCAGTGG + Exonic
1080816405 11:35761789-35761811 TGCATGTCTCCTCTTAAAGATGG + Intronic
1087300081 11:96422640-96422662 TTCATGTGTACTCTTATCCCAGG + Intronic
1089555390 11:119313143-119313165 TTCATGTCTGCTCATATCCAAGG + Intronic
1090037673 11:123263008-123263030 TTCAGGTCTGCTCTGATTGGAGG + Intergenic
1094372626 12:29754378-29754400 GTCATGTCTCCTCTGATCTTGGG - Intronic
1097585815 12:61514892-61514914 TTTCTGTCTCCTCTTTTCTGTGG - Intergenic
1099388053 12:82042418-82042440 TACATGACTCTTCTTATAGGAGG - Intergenic
1099490208 12:83279743-83279765 TTCATGTCTCCCTTTATGGTGGG + Intergenic
1104236532 12:126943784-126943806 TACATGGCTTTTCTTATCGGTGG - Intergenic
1119116066 14:72022732-72022754 TTCATGCTTCCTATTATCAGTGG + Intronic
1122932489 14:104940755-104940777 GTCATGTCTCCTCTTAGCCCTGG - Exonic
1123899667 15:24863708-24863730 TTCATGTCTCCTCATTTCAGGGG + Intronic
1124591125 15:31053996-31054018 TACATGACTCCACTTATAGGAGG + Intronic
1124868940 15:33521644-33521666 TTCCTGTCTCCTCATATCACAGG - Intronic
1125324839 15:38526114-38526136 TTCATGTATCCTCTGTTGGGTGG - Intronic
1126710297 15:51447425-51447447 TTCCTGGCTCTTCTTATCAGTGG + Intergenic
1127588083 15:60397365-60397387 TTAATGTCTTCTTTTATGGGGGG + Intronic
1131625950 15:94120868-94120890 TACATGGATCCACTTATCGGTGG + Intergenic
1140472255 16:75222528-75222550 GTCATGTCTCCTCCTACCTGGGG - Intronic
1145370358 17:22302218-22302240 TCCATGTTTCATCTCATCGGTGG + Intergenic
1152836318 17:82534719-82534741 TTCCTGTCTCCTCTTACAGATGG + Intronic
1153838965 18:8989384-8989406 TTCAAATCTGCTCTTATAGGAGG + Intergenic
1154456219 18:14528593-14528615 TTCATGTCTCCTTTCATGGTTGG - Intronic
1155130987 18:22933960-22933982 TTCAGGGGTCCTCTTATGGGCGG - Exonic
1157556231 18:48614631-48614653 TGCATGATTCCTCTTATAGGAGG + Intronic
1157879527 18:51306976-51306998 TTCCTGTCTTCTCTTATCCCTGG - Intergenic
1162233567 19:9286696-9286718 TTCATGTTTCCTCATATAAGTGG + Intergenic
940218457 2:151325380-151325402 TCCATGTCTCTTCTTCTCTGTGG - Intergenic
940913880 2:159233540-159233562 TTCATGTCCCCTCTTACTGATGG + Intergenic
942035039 2:172002571-172002593 TTCTTCTCTCCTCTAATCAGAGG - Intronic
942856363 2:180554477-180554499 TTCATGATTCCTCTTATATGAGG + Intergenic
943081894 2:183266127-183266149 TTCATGTTTCCACTTATAAGTGG + Intergenic
944053327 2:195496121-195496143 GCCATGTCTCCTCTTAGAGGAGG - Intergenic
944682754 2:202091883-202091905 TTCAAGTCACCACTTATTGGGGG - Intronic
944874226 2:203945224-203945246 TTCATGTCTTCCCTTATCTGTGG - Intronic
1173057372 20:39628491-39628513 TTCATGTCTCCTCTTCTTCCTGG - Intergenic
1173861532 20:46286884-46286906 TTCATGTCTCTTCCTTTCTGTGG + Intronic
1176817946 21:13624743-13624765 TTCATGTCTCCTTTCATGGTTGG + Intronic
1178471701 21:32899339-32899361 TTCATGTCTCCTTTCTTCTGTGG + Intergenic
1182893370 22:33838014-33838036 TGCCTGTTTCCTCTTATCTGTGG - Intronic
953605448 3:44410459-44410481 TTCGTGCCTCCTTTTATAGGTGG - Intergenic
955995693 3:64678302-64678324 TCCATGTCTCCTCTTCTCATAGG - Intronic
964811185 3:160666373-160666395 TACATGTCACCTCTTCTGGGAGG + Intergenic
973831786 4:54768582-54768604 TTCCTGTTTCCTCTTTTAGGTGG + Intergenic
984201344 4:176724622-176724644 TTCCTGTCTCCTCTTTCCTGAGG - Intronic
992383224 5:76259035-76259057 TTCCTGTCTTCTCCTATTGGGGG + Intronic
992404296 5:76442103-76442125 TTAATGTCTCATCTGATGGGGGG - Intronic
996769496 5:127071390-127071412 TTCATGTTTCCTGTTCTCCGTGG + Intronic
1005452259 6:25984893-25984915 TTCATTTCTCCTATTCTCAGAGG - Exonic
1007571263 6:42892642-42892664 TTTATGTCTCCTTTAATCTGGGG - Intergenic
1007921933 6:45618003-45618025 TTCAGGTTTCCTCTTTTCAGTGG + Intronic
1017314695 6:153017044-153017066 TGCATGTCTCCTCTTATCTCAGG + Intronic
1018522691 6:164668903-164668925 TGCATGTCTCCACTGATCAGTGG - Intergenic
1019627589 7:2027857-2027879 TTCATGCCTCTTCTTATCTGTGG - Intronic
1022338430 7:29445303-29445325 CTCATGTCTCCTGTTAATGGAGG + Intronic
1024520410 7:50300894-50300916 TGCATGTCTCCTCTGATGGTTGG - Intergenic
1028400919 7:90424515-90424537 TTCATTTCAGGTCTTATCGGGGG - Intronic
1030639563 7:111988884-111988906 TTCATGTTTCCTGTTTTTGGAGG - Intronic
1031400815 7:121324742-121324764 TTCAACTCTACTCTCATCGGAGG - Intergenic
1034504518 7:151476819-151476841 TTCATGTCTCCTCTTATCGGGGG - Intronic
1040082845 8:43306624-43306646 TTCATGTCTCCTTTCATGGTTGG + Intergenic
1042792339 8:72622381-72622403 TGAATGTCTCCTATTATTGGAGG - Intronic
1048312322 8:133334918-133334940 TTCAAGTCTTCTCTTATTTGAGG + Intergenic
1051720613 9:20033333-20033355 TGCAAGTCTCCACTTATCTGTGG - Intergenic
1054931911 9:70643923-70643945 TTCATGCCTCCTTATATGGGAGG + Intronic
1057154109 9:92825263-92825285 TTCATGTCTCCTTTCATGGTTGG + Intergenic
1203529413 Un_GL000213v1:124760-124782 TTCATGTCTCCTTTCATGGTTGG - Intergenic
1188357108 X:29205084-29205106 TTCAAGTCTCTTATTATGGGGGG + Intronic
1191891533 X:65947507-65947529 TTCATGTCTTCTGTTAAAGGAGG - Intergenic