ID: 1034506728

View in Genome Browser
Species Human (GRCh38)
Location 7:151498166-151498188
Sequence CCTTGAAGGTTCCTCAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034506728_1034506734 13 Left 1034506728 7:151498166-151498188 CCTGGCTTGAGGAACCTTCAAGG 0: 1
1: 0
2: 1
3: 7
4: 120
Right 1034506734 7:151498202-151498224 AATAGAGTTTAAAGTACTGGAGG No data
1034506728_1034506735 22 Left 1034506728 7:151498166-151498188 CCTGGCTTGAGGAACCTTCAAGG 0: 1
1: 0
2: 1
3: 7
4: 120
Right 1034506735 7:151498211-151498233 TAAAGTACTGGAGGCAATTAAGG No data
1034506728_1034506736 28 Left 1034506728 7:151498166-151498188 CCTGGCTTGAGGAACCTTCAAGG 0: 1
1: 0
2: 1
3: 7
4: 120
Right 1034506736 7:151498217-151498239 ACTGGAGGCAATTAAGGAAGAGG No data
1034506728_1034506733 10 Left 1034506728 7:151498166-151498188 CCTGGCTTGAGGAACCTTCAAGG 0: 1
1: 0
2: 1
3: 7
4: 120
Right 1034506733 7:151498199-151498221 GTAAATAGAGTTTAAAGTACTGG 0: 1
1: 0
2: 2
3: 11
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034506728 Original CRISPR CCTTGAAGGTTCCTCAAGCC AGG (reversed) Intronic
900120170 1:1045469-1045491 CCTCGAAAGTTCCAGAAGCCAGG - Exonic
901887305 1:12231316-12231338 CCTTGAAGTGGCCTCAAGCACGG + Intronic
902601956 1:17546038-17546060 CATTGAACCTTCCTCAAGTCAGG + Intronic
906178946 1:43801451-43801473 TCTTGAAGGTTCCTGAAGCCAGG - Intronic
911189420 1:94933001-94933023 CCATGAAGGTTCCTGAAGTGGGG - Intergenic
914885856 1:151583826-151583848 CCTTGTAGGATCCCTAAGCCTGG + Intergenic
915001473 1:152597712-152597734 CCTTGAAACTTCCCCAGGCCAGG - Intronic
916976216 1:170082446-170082468 CCCTAAAGTTTCCTCCAGCCTGG - Intronic
920183955 1:204149178-204149200 CCTTGACAGTTCCCCAAACCTGG + Intronic
920199375 1:204250111-204250133 CCCTGAAGCTCCCTGAAGCCAGG + Intronic
920682598 1:208084280-208084302 CCTGGAAGGCTCCGGAAGCCAGG + Intronic
921032667 1:211347339-211347361 TTCTGAAGCTTCCTCAAGCCTGG - Intronic
1063451355 10:6152401-6152423 CCATGGAGGCTCCCCAAGCCAGG + Intronic
1067337297 10:45375760-45375782 TCTTGAAGGGAGCTCAAGCCAGG - Intronic
1070951820 10:80437233-80437255 CCTTGGAAGTTCCTCCAGCTGGG - Intergenic
1072845695 10:98827733-98827755 GCTTTAAGGTTGCTGAAGCCAGG + Intronic
1075925077 10:126245124-126245146 CCTTGAGGGTTCCCCGAGGCTGG - Intronic
1077341033 11:2026422-2026444 CTTTGAAGCCCCCTCAAGCCTGG - Intergenic
1079253143 11:18802419-18802441 CCTTGCAGCTTCTTCTAGCCTGG + Intergenic
1084270574 11:68027149-68027171 CCTCTAAGGCTCCCCAAGCCTGG + Intronic
1084797622 11:71519020-71519042 CCGGGCAGGTTCCTCAAGCCCGG - Intronic
1089891958 11:121890418-121890440 CCCTGAATGTTCCTCCTGCCTGG - Intergenic
1090089250 11:123680069-123680091 CCTTAAAGGTTCTTCAGGCAAGG - Intergenic
1202824018 11_KI270721v1_random:81611-81633 CTTTGAAGCCCCCTCAAGCCTGG - Intergenic
1091817738 12:3452763-3452785 CCTTGAACGTTCCCCAGTCCAGG - Intronic
1095839532 12:46677353-46677375 CCTGGCAGGTTCCTCGGGCCAGG - Intergenic
1107837206 13:44421655-44421677 CCTTGAAGGAACTTCTAGCCAGG - Intergenic
1122532040 14:102435030-102435052 CCGTGGAGGCTGCTCAAGCCAGG - Exonic
1122853562 14:104548972-104548994 CCTTGGAGGTTCCACAAACGAGG + Intronic
1124654498 15:31497638-31497660 CCCTGAAGGTTCCTGAGTCCTGG + Intronic
1124788263 15:32701919-32701941 CTTTGAAGCCTCCTGAAGCCTGG + Intergenic
1127990482 15:64111721-64111743 CATAAAAGGTTCCTTAAGCCAGG + Intronic
1128871074 15:71155664-71155686 CCTTGAAGGTGCCCCAAGAGAGG - Intronic
1130605799 15:85315560-85315582 CCTTGCAGGTTCCTCCAACATGG + Intergenic
1130781783 15:87047478-87047500 CCTTGCAGGTTCCTAGAGTCAGG + Intergenic
1132610981 16:816238-816260 CCTAGAAGGTCCCTCAACCGGGG + Intergenic
1134208997 16:12260279-12260301 CCTTGTAGGTTCCTGGAGCAGGG + Intronic
1134855214 16:17513023-17513045 CCTTGAAGGGTCATCAAGACAGG - Intergenic
1136268508 16:29134361-29134383 TCTTGATGGTTCCTAGAGCCTGG + Intergenic
1137809163 16:51336267-51336289 GCTTGAAGGATCTGCAAGCCAGG - Intergenic
1140100115 16:71908709-71908731 CCTTTCTAGTTCCTCAAGCCAGG + Intronic
1141749241 16:85947113-85947135 CCTGCCAGGTTCCCCAAGCCTGG - Intergenic
1142028521 16:87827089-87827111 CCGGGAAGGTTCCTGAAGACAGG - Intergenic
1142071819 16:88094698-88094720 TCTTGATGGTTCCTAGAGCCTGG + Intronic
1144357252 17:14458084-14458106 CCATTAAGGTTCCTGAAACCAGG - Intergenic
1145796963 17:27661147-27661169 CCTGGCTGGTTCCACAAGCCTGG + Intergenic
1146398245 17:32485559-32485581 CCCCCAAGGTTCCTAAAGCCTGG + Intergenic
1146591773 17:34133587-34133609 CTACGAAGGCTCCTCAAGCCAGG - Intronic
1150628778 17:66861596-66861618 CCTTGCAGGCTTCTGAAGCCTGG + Intronic
1152614330 17:81330948-81330970 CCTTGTTGGTTCCACAAGCTGGG - Intergenic
1153260464 18:3219024-3219046 CCTTGAAGTTAACTAAAGCCAGG + Intronic
1156018687 18:32575441-32575463 CCTTGGAGGGTCCACAAGCTTGG + Intergenic
1156884460 18:42118222-42118244 CCTACAAAGTTCCTCAGGCCTGG + Intergenic
1168581483 19:57559244-57559266 CGTTCAAGCTTCCTCAACCCCGG + Intronic
925134530 2:1516842-1516864 CCTGGAAGGTTCTTCTAACCAGG + Intronic
927442383 2:23128359-23128381 CCCTGAAGCTGCCCCAAGCCTGG - Intergenic
928469861 2:31563500-31563522 CCTGGAAGTTTTCTCAAACCAGG - Intronic
929009592 2:37427873-37427895 CCTGGAGGGTTCTTCAAGTCAGG + Intergenic
931238604 2:60432915-60432937 CCTTGATGGTTCCTGAAGAAAGG - Intergenic
932070333 2:68613415-68613437 CCTTAAAGGTTCCACAGGGCAGG + Intronic
933485571 2:82918588-82918610 TTTTGAAGATTCTTCAAGCCAGG - Intergenic
934616194 2:95772760-95772782 CCATGAGGGTTCCTGAAGGCTGG - Intergenic
934644701 2:96051800-96051822 CCATGAGGGTTCCTGAAGGCCGG + Intergenic
934838116 2:97607890-97607912 CCATGAGGGTTCCTGAAGGCTGG + Intergenic
935337738 2:102033037-102033059 TCTTGTAAGTTCCTCAAGGCAGG + Intergenic
935901418 2:107797722-107797744 CTGTGAAGCTTCCTCAGGCCTGG + Intergenic
942565477 2:177261797-177261819 CCTTAACTGTTCCTCAAGCCTGG - Intronic
943638956 2:190338434-190338456 CCTTGAAGGCTCCTCCTGCAAGG - Intronic
945773571 2:214077244-214077266 CCTTGAAGGCTTCTCATTCCTGG - Intronic
945905142 2:215584516-215584538 GCTTGAAGATTCTTCAGGCCTGG - Intergenic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
947715166 2:232335632-232335654 CCCTGAAGCTCCCTCCAGCCAGG + Intronic
948377404 2:237530550-237530572 TCTGGAAGCTTCCTCAACCCTGG + Intronic
1169476856 20:5939631-5939653 CCATGAAGCTTCCTGAAGCCAGG - Intronic
1170507677 20:17045169-17045191 CCTTGGAGGTTCTTTTAGCCTGG - Intergenic
1172299274 20:33837485-33837507 CCTTGAGGGATCCCCTAGCCTGG - Intronic
1173220163 20:41125860-41125882 CCTTGAAGGATGCTTAACCCAGG + Intergenic
1180817722 22:18802470-18802492 CCTTCAGGATTCCTCGAGCCTGG + Intergenic
1181203938 22:21236927-21236949 CCTTCAGGATTCCTCGAGCCTGG + Intergenic
1185315773 22:50178510-50178532 CTTTGAGGGGGCCTCAAGCCAGG - Intronic
1203222983 22_KI270731v1_random:58487-58509 CCTTCAGGATTCCTCGAGCCTGG - Intergenic
1203267846 22_KI270734v1_random:28333-28355 CCTTCAGGATTCCTCGAGCCTGG + Intergenic
949740549 3:7228485-7228507 TCTCAAAGGTTCCTTAAGCCAGG - Intronic
950194193 3:10997552-10997574 CCTTGAATGTCCCTCTGGCCAGG - Intronic
950615129 3:14152180-14152202 CCTTGAATCCTGCTCAAGCCGGG + Intronic
957471047 3:80657726-80657748 CCTTGCAGGTTCCTCCTGCAAGG - Intergenic
959117228 3:102192837-102192859 CCTTTAAGGTTCCTAAGGACAGG - Intronic
960161752 3:114357179-114357201 CCTTGATGGTTCCTCCACACTGG - Intronic
961431968 3:126889925-126889947 CTTTGATGGTTCCTCTACCCAGG - Intronic
968001691 3:195210953-195210975 TCTTGATGGTTCCCCAAGCCTGG - Intronic
975844595 4:78511646-78511668 CTGTGAAGGTCCCTCAAGCTCGG + Intronic
979891948 4:126108759-126108781 TATTGAAGGTTCTACAAGCCAGG - Intergenic
982646191 4:158027321-158027343 CCAGGAAGGTTCTCCAAGCCTGG + Intergenic
983187286 4:164714738-164714760 CCTTGTAGGTGCCTGAAGCAGGG + Intergenic
988861112 5:35280671-35280693 CATTGAATTTTCCTCAATCCAGG - Intergenic
992211814 5:74487276-74487298 CCTTCAATGTTCTCCAAGCCTGG + Intergenic
994038060 5:95225421-95225443 CCTTGTATGTTCCTATAGCCTGG - Intronic
1000582237 5:163048618-163048640 CCTGGAAGGAGCCTGAAGCCAGG - Intergenic
1004280558 6:14276231-14276253 CCTAGAAGGTTCCCCAAACCAGG + Intergenic
1005619036 6:27602955-27602977 CTTTGAGGGTCCCTCTAGCCAGG - Intergenic
1007494187 6:42248227-42248249 CTTTGATGGGTCCTCAAGCCAGG + Intronic
1012069406 6:94593545-94593567 CCTTGAAGTCTCATCAAGTCAGG + Intergenic
1015886628 6:137924641-137924663 CCTTGGAGTTTTCTCATGCCTGG + Intergenic
1018846620 6:167561312-167561334 ACTTGCAGGTTCCCCAAGGCAGG + Intergenic
1018891727 6:167987681-167987703 CCTCGAAGGCCCCACAAGCCAGG + Intergenic
1020129137 7:5549642-5549664 CCTTGCCAGTTCCTCAAGCTGGG - Intronic
1021414451 7:20365946-20365968 CCTTGAAAATTATTCAAGCCAGG - Intronic
1021743187 7:23709535-23709557 CCTCAAAGTTTCCTCATGCCCGG - Intergenic
1024237403 7:47408781-47408803 CTTTGTGGGTGCCTCAAGCCTGG + Intronic
1024273407 7:47659146-47659168 CCTGGAAGGATGCTCAGGCCTGG + Exonic
1024506646 7:50167707-50167729 CCTTCAAGGTTCCTGGAGTCTGG + Intergenic
1026114252 7:67483086-67483108 CCTTGATGGTTTCTTAAGCATGG + Intergenic
1029945641 7:104529847-104529869 CCTTGTTGGTTCATCCAGCCTGG - Intronic
1034506728 7:151498166-151498188 CCTTGAAGGTTCCTCAAGCCAGG - Intronic
1038794573 8:30698556-30698578 CCTTGAAGATACCTCAGACCAGG - Intronic
1039981712 8:42414006-42414028 CCTTGAAGGCTCCTGGAGTCTGG - Intergenic
1045235969 8:100352818-100352840 CCTTGAAGGTTTCTCAGGGGAGG + Intronic
1051191220 9:14515480-14515502 CCATGAGTGTTCCTCTAGCCAGG + Intergenic
1053292295 9:36889177-36889199 CCTTGGAGTTCCCACAAGCCAGG + Intronic
1056014473 9:82368772-82368794 CCATGAAGGTTCCCCATGCTAGG + Intergenic
1056956438 9:91085296-91085318 CCATGAAGGTTCCTGAAGGATGG + Intergenic
1057726084 9:97569150-97569172 CCTTGGAGGTCCCTCAAAGCTGG - Intronic
1058466987 9:105238503-105238525 TCTTGAAGTTTACTCATGCCCGG - Intergenic
1059560555 9:115330576-115330598 ACTTAAAGGTTACTCAAACCGGG - Intronic
1188615488 X:32153777-32153799 ACTTGAAGCTTTCTCTAGCCAGG + Intronic
1190237409 X:48627116-48627138 CCTTGAACATTTCTCAACCCTGG - Intergenic
1193549337 X:82871461-82871483 CATTGAAGGTGCCACAATCCAGG + Intergenic
1194763913 X:97827116-97827138 CATTGTATGTTCCTCAAGGCTGG - Intergenic
1197158000 X:123291225-123291247 CCTTGAAGGTGCTGGAAGCCTGG + Intronic