ID: 1034506728

View in Genome Browser
Species Human (GRCh38)
Location 7:151498166-151498188
Sequence CCTTGAAGGTTCCTCAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034506728_1034506736 28 Left 1034506728 7:151498166-151498188 CCTGGCTTGAGGAACCTTCAAGG 0: 1
1: 0
2: 1
3: 7
4: 120
Right 1034506736 7:151498217-151498239 ACTGGAGGCAATTAAGGAAGAGG No data
1034506728_1034506735 22 Left 1034506728 7:151498166-151498188 CCTGGCTTGAGGAACCTTCAAGG 0: 1
1: 0
2: 1
3: 7
4: 120
Right 1034506735 7:151498211-151498233 TAAAGTACTGGAGGCAATTAAGG No data
1034506728_1034506734 13 Left 1034506728 7:151498166-151498188 CCTGGCTTGAGGAACCTTCAAGG 0: 1
1: 0
2: 1
3: 7
4: 120
Right 1034506734 7:151498202-151498224 AATAGAGTTTAAAGTACTGGAGG No data
1034506728_1034506733 10 Left 1034506728 7:151498166-151498188 CCTGGCTTGAGGAACCTTCAAGG 0: 1
1: 0
2: 1
3: 7
4: 120
Right 1034506733 7:151498199-151498221 GTAAATAGAGTTTAAAGTACTGG 0: 1
1: 0
2: 2
3: 11
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034506728 Original CRISPR CCTTGAAGGTTCCTCAAGCC AGG (reversed) Intronic