ID: 1034507414

View in Genome Browser
Species Human (GRCh38)
Location 7:151504428-151504450
Sequence TCATATATGCAGATTCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 5, 2: 8, 3: 58, 4: 354}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034507414_1034507417 1 Left 1034507414 7:151504428-151504450 CCCTGCAGAATCTGCATATATGA 0: 1
1: 5
2: 8
3: 58
4: 354
Right 1034507417 7:151504452-151504474 AAGTCGGCCCTCCATACATGTGG 0: 1
1: 1
2: 16
3: 46
4: 204
1034507414_1034507422 16 Left 1034507414 7:151504428-151504450 CCCTGCAGAATCTGCATATATGA 0: 1
1: 5
2: 8
3: 58
4: 354
Right 1034507422 7:151504467-151504489 ACATGTGGGCTTTGCATCCAAGG 0: 1
1: 0
2: 2
3: 27
4: 189
1034507414_1034507418 2 Left 1034507414 7:151504428-151504450 CCCTGCAGAATCTGCATATATGA 0: 1
1: 5
2: 8
3: 58
4: 354
Right 1034507418 7:151504453-151504475 AGTCGGCCCTCCATACATGTGGG 0: 1
1: 5
2: 21
3: 95
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034507414 Original CRISPR TCATATATGCAGATTCTGCA GGG (reversed) Intronic
901648718 1:10730354-10730376 TCATATTTGCAGCTTCATCAAGG - Intronic
902459943 1:16566801-16566823 TCAAATACTCAGATTCTTCATGG + Intronic
904957184 1:34294624-34294646 TCACATATTCAGTTTCTGCTGGG + Intergenic
905488340 1:38323703-38323725 TCTTCTCTGCACATTCTGCATGG - Intergenic
905962357 1:42054149-42054171 TCTAATATCCAGATTCTACAAGG - Intergenic
906359231 1:45138592-45138614 TCAAATAAGCAGGTTCCGCAGGG + Intronic
907535485 1:55151740-55151762 TTATTTCTGTAGATTCTGCAGGG - Intronic
908902737 1:68974761-68974783 TTATAGATGCAGATTCTTAAAGG - Intergenic
909095595 1:71283789-71283811 TCTAATATGCAGAATCTGTAAGG - Intergenic
909107686 1:71433023-71433045 TCATAATTGCAGATTCTAAAAGG - Intronic
909316018 1:74220437-74220459 TAATAGAAGCAGATGCTGCATGG + Intronic
910067953 1:83176161-83176183 CCAAATTTGCAGCTTCTGCAAGG - Intergenic
910096611 1:83529813-83529835 TCTAATATCCAGAGTCTGCATGG + Intergenic
912019072 1:105081653-105081675 TCAAATATCCAGAATCTACAAGG - Intergenic
912674563 1:111666370-111666392 TAATATATGCACATGTTGCATGG - Intronic
913448395 1:118974061-118974083 TTAGAAATGTAGATTCTGCAAGG - Intronic
913989542 1:143597984-143598006 TCAAATATTCAGATTGTTCATGG + Intergenic
915991058 1:160517122-160517144 TCTAATATCCAGATTCTACAAGG + Intronic
916984802 1:170179595-170179617 TTATGTGTGCAGATTCTGGAGGG + Intergenic
918518674 1:185390269-185390291 TCAGATATACAGTTTCTTCATGG - Intergenic
918684202 1:187395393-187395415 TGATAGATGCAGATTCTGCTAGG + Intergenic
919196797 1:194296733-194296755 TCATATTTCTTGATTCTGCAAGG - Intergenic
921497545 1:215859589-215859611 TCATATACATGGATTCTGCACGG + Intronic
921535307 1:216342108-216342130 TCTAATATCCAGAATCTGCAAGG + Intronic
921869845 1:220128179-220128201 TCATATATGCAGTTTCAGCAGGG + Intronic
922793297 1:228322601-228322623 TCATATATATAGGTTCTGCAGGG - Intronic
923554822 1:234992307-234992329 TCATACCTGCAGATTCTGCAGGG - Intergenic
923861660 1:237897911-237897933 ACCTATATGCAGGTTCTGCAGGG - Intergenic
924799442 1:247316969-247316991 TCATGTGAGAAGATTCTGCATGG - Intronic
924831081 1:247595817-247595839 TCTTATATCCAGAATCTACAAGG + Intergenic
1065034808 10:21626834-21626856 TCACATATACAGATGCTGAAAGG - Intronic
1066284777 10:33954083-33954105 TCACATATGCAGAATATGAAAGG + Intergenic
1066679358 10:37921940-37921962 TCTAATATGCAGAATCTGTAAGG + Intergenic
1067236563 10:44455437-44455459 TAATATATTCAGAATCTACAAGG - Intergenic
1067252498 10:44599426-44599448 TCTAATATCCAGAATCTGCAAGG + Intergenic
1068055243 10:52005159-52005181 TCATATATGCCATTTCTCCAGGG - Intronic
1068164401 10:53309512-53309534 TCATAGAAGCAGATTGTGAATGG + Intergenic
1068464219 10:57367303-57367325 TCACAAATGCAGAATCTGAAAGG - Intergenic
1068482085 10:57604333-57604355 TTGTTTATGCAGGTTCTGCAGGG - Intergenic
1068821923 10:61387418-61387440 TCATATATCCAAATTCTTAAGGG + Intergenic
1069184108 10:65400860-65400882 TCATATGTGCAGATTTTACAGGG - Intergenic
1069624000 10:69855967-69855989 TCATTCATGCATATTCAGCAAGG + Intronic
1070583114 10:77738927-77738949 CCATACATGCAGGTACTGCAGGG + Intergenic
1071752475 10:88496091-88496113 ACATTTATGCAGCTTCTGGAAGG + Intronic
1073641220 10:105254575-105254597 TCTTACATGCAGGTTCTGCAGGG - Intronic
1074664247 10:115700576-115700598 TCTAATATGCAGAATCTACAAGG - Intronic
1075076533 10:119354864-119354886 TCATATACTCAGGTTCTGTAGGG + Intronic
1075253873 10:120908571-120908593 CTATATATGCAGATTATGCCCGG + Exonic
1075705110 10:124495779-124495801 TCATCTGGGCAGCTTCTGCATGG + Intronic
1076047887 10:127309317-127309339 TCTGATATCCAGAATCTGCAAGG - Intronic
1076211883 10:128655119-128655141 TCTAATATCCAGAATCTGCAAGG + Intergenic
1076332655 10:129681715-129681737 TCATATACACAGAATCTACAGGG + Intronic
1076545771 10:131244965-131244987 TAACATAGGCAGATGCTGCAGGG + Intronic
1077457600 11:2690258-2690280 ACATATGTGCAGATGCAGCAAGG - Intronic
1078089306 11:8254475-8254497 GCATATATGCAGATGCAGCCAGG - Intronic
1078265159 11:9749992-9750014 TCAGTTATGTAGATACTGCATGG + Exonic
1080466310 11:32500517-32500539 TCATAGAAGCAGATTTCGCAAGG + Intergenic
1081015244 11:37870191-37870213 TCATATATGTGGATTCTGTAGGG + Intergenic
1081273056 11:41110999-41111021 TCAGAGATGCAGATGCTGAAGGG + Intronic
1082967450 11:58981353-58981375 TAATATATGCTGATTATACAAGG + Intronic
1083557352 11:63641308-63641330 ACATATATGTAGATTATGAATGG - Intronic
1083832710 11:65243054-65243076 TTAAACATGCAGCTTCTGCAAGG - Intergenic
1084643449 11:70439909-70439931 TCATAGATGTGGGTTCTGCAGGG - Intergenic
1085974058 11:81630409-81630431 TCAAATATCAATATTCTGCAAGG + Intergenic
1086048567 11:82561953-82561975 TCCTGTAGGCAGATACTGCAAGG - Intergenic
1086124117 11:83332265-83332287 TCATAAAGACAGATTCTGAATGG - Intergenic
1086610791 11:88753216-88753238 TCTTATATCCAGATTCTACAAGG + Intronic
1086806627 11:91251838-91251860 TCAAATATCCAGAATCTGCAAGG - Intergenic
1087079282 11:94154177-94154199 TGATAGATCCAGATACTGCAGGG + Intronic
1088094305 11:106080248-106080270 TCATATATGCAGGTTCCATAGGG + Intronic
1088271356 11:108037700-108037722 TCATGTAAGCAGCTTCTGCCTGG + Intronic
1088295027 11:108283737-108283759 TCATATACGTGGGTTCTGCAGGG - Intronic
1088342501 11:108784569-108784591 TCTAATATCCAGAATCTGCAAGG - Intronic
1089134278 11:116236879-116236901 ACATATATTCAGATTCAGAAAGG + Intergenic
1089562967 11:119354866-119354888 TCATATACGCAGGTTCTGCAGGG + Intergenic
1091804896 12:3348755-3348777 TCATGTATGTGGGTTCTGCAGGG - Intergenic
1091817418 12:3449612-3449634 TCTAATATCCAGATTCTACAAGG - Intronic
1093743194 12:22711553-22711575 TCATTTATGGAGGTTCTGTAAGG + Intergenic
1094548079 12:31423591-31423613 TCATACCTGGTGATTCTGCAAGG + Exonic
1095259015 12:40077032-40077054 TCTAATATCCAGATTCTGTAAGG - Intronic
1096571329 12:52525014-52525036 TCATATATGTAAAGTGTGCAGGG - Intergenic
1097583114 12:61482423-61482445 GCATATAATCAGATTCTGTAAGG + Intergenic
1097698076 12:62794036-62794058 ACAAATAATCAGATTCTGCATGG + Intronic
1098220454 12:68264768-68264790 TGATTTATGCTGAATCTGCAAGG + Intergenic
1098266574 12:68727789-68727811 TCGTATATGCAGGTTCTGCAGGG - Intronic
1098450876 12:70616945-70616967 TTGTATATGCAGGTTTTGCAAGG - Intronic
1098700754 12:73622493-73622515 TCTGATATCCAGAATCTGCAAGG - Intergenic
1098800739 12:74954172-74954194 TTAAATATGCAAAATCTGCATGG + Intergenic
1098949424 12:76624148-76624170 TCATATAGGCAGCCTCTGCTAGG + Intergenic
1099062798 12:77932933-77932955 TTATTTATGCATATTCTGCATGG + Intronic
1099130952 12:78830388-78830410 GCATATATTCAGCTTCTGTAAGG + Intergenic
1099228463 12:79996095-79996117 TCTAATATCCAGATTCTACAAGG - Intergenic
1099460380 12:82913883-82913905 TCCTATATTCTGGTTCTGCAGGG - Intronic
1100169408 12:91957215-91957237 TCTAATATCCAGAATCTGCAAGG + Intergenic
1100603134 12:96129428-96129450 TGATAAATGCAGATTTTTCAAGG - Intergenic
1100628146 12:96358302-96358324 ACAGATATGCAGATTATGCAGGG + Intronic
1100677911 12:96888074-96888096 GCATATGTGCAGATTCTACATGG + Intergenic
1101213631 12:102559779-102559801 TCATATATGCTGGTTCTGCAGGG + Intergenic
1101502426 12:105316597-105316619 TCATATAAGCAGATTCTGCAGGG + Intronic
1104191534 12:126486209-126486231 TCACATATGCATGTTCTGCAGGG - Intergenic
1104454906 12:128903146-128903168 TCATCTATGCCAATTCTGGAGGG - Intronic
1106444622 13:29815935-29815957 TCAAATAACCAGTTTCTGCATGG + Intronic
1106515824 13:30452834-30452856 TCATATATTCTTATTCTGCTGGG - Intergenic
1106616784 13:31337798-31337820 TCTTATATCCAGAGTCTACAAGG + Intergenic
1107950570 13:45457858-45457880 TGGTATATGCAATTTCTGCAGGG - Intergenic
1107957441 13:45529804-45529826 TCTTATATGCAGTTGCCGCAAGG - Exonic
1108149042 13:47512408-47512430 TCACATATACAGATTCTGGAGGG + Intergenic
1108822480 13:54370375-54370397 ACATATATCCAGAATCTACAAGG - Intergenic
1110778030 13:79432748-79432770 TTAAGTATGCAGATTCTGGAGGG - Intergenic
1111109098 13:83684306-83684328 ACAAATGTGCAGATTCTGCCAGG - Intergenic
1111150982 13:84253408-84253430 TCTAATATCCAGATTCTACAAGG - Intergenic
1111158814 13:84365885-84365907 TCATACATGCAGGTTCTGTACGG + Intergenic
1111162026 13:84407075-84407097 GGATAGATGCAGATTCTGTAAGG - Intergenic
1112242004 13:97691585-97691607 TCTAATATCCAGAGTCTGCAGGG + Intergenic
1112650908 13:101397266-101397288 TGATACATGCAGGATCTGCATGG - Intronic
1113247144 13:108410258-108410280 TAATATATTCAGACTCTGCGTGG + Intergenic
1113803353 13:113097737-113097759 ACAAAGATGCAGTTTCTGCAGGG + Intronic
1114213426 14:20635893-20635915 TCAAATATCCAGAATCTACAAGG + Intergenic
1114480464 14:23030621-23030643 TCATATATGCAGGTTCTGCAGGG - Intronic
1114655655 14:24314151-24314173 TCATAAATCCAGACTCAGCAGGG + Exonic
1114766905 14:25382873-25382895 TCATATATACATATTCTGCCTGG - Intergenic
1115919155 14:38353738-38353760 ACATATATACAGGATCTGCATGG + Intergenic
1116685249 14:48031019-48031041 TCTAATATCCAGAATCTGCAAGG - Intergenic
1117348741 14:54860071-54860093 TCATATATGCAGGTTCTGCAGGG - Intronic
1117849856 14:59956707-59956729 TAATTTATGCAGTTTCTTCATGG + Intronic
1117889639 14:60405309-60405331 TCTTATATCCAGAGTCTGCAAGG - Intronic
1118963426 14:70556770-70556792 TCGTATACACAGGTTCTGCAGGG + Intergenic
1120896021 14:89533365-89533387 TCAGATATGCAGATTCTGGCTGG + Intronic
1124473909 15:30014319-30014341 TCTAATATCCAGATTCTGTAGGG - Intergenic
1124822784 15:33063994-33064016 TCATTTACACAGTTTCTGCAGGG - Intronic
1125185312 15:36923355-36923377 TCATATATGTTCATTCTGCTAGG + Intronic
1125244433 15:37618704-37618726 TCTTATATCCAGAATCTACAAGG - Intergenic
1126500688 15:49340642-49340664 TCTTATATCCAGAATCTGTAAGG - Intronic
1127901378 15:63343575-63343597 TCATATAAGAAGATTCTGGTGGG - Intronic
1128761652 15:70220149-70220171 TCATATATGCAGGTTCTGCAGGG - Intergenic
1128901697 15:71428380-71428402 TAATATGAGCTGATTCTGCAAGG - Intronic
1129809198 15:78493328-78493350 TCATATATGTGGCTTCTGCAAGG - Intronic
1134211005 16:12276788-12276810 CCATATATGCCCACTCTGCAGGG - Intronic
1135577239 16:23595442-23595464 TCCTATAAGCGGATTCTGCAAGG - Intronic
1135586099 16:23672273-23672295 TCTTATAATGAGATTCTGCAAGG - Exonic
1135847994 16:25936305-25936327 TCAGATATGCAGATGATACAAGG + Intronic
1137527573 16:49249771-49249793 TCTTACTTGCAGATTCTGGAAGG - Intergenic
1138837353 16:60454891-60454913 TCTAATATGCAGAATCTACAAGG - Intergenic
1138862082 16:60770963-60770985 TCATATTTACTGATTGTGCAAGG - Intergenic
1141219212 16:82053354-82053376 TCATTTCTGTAGACTCTGCAGGG - Intronic
1144121296 17:12156029-12156051 TCAAATATCCAGAGTCTACAAGG + Intergenic
1147291090 17:39443804-39443826 TCATATATATGGATTTTGCATGG - Intronic
1147772463 17:42877522-42877544 TCACAAATGCATATTCCGCATGG - Intergenic
1148208177 17:45792526-45792548 TCATATATGTATATTCTGCTGGG - Intronic
1148763410 17:50021428-50021450 GCACATCTGCAGATTGTGCAAGG - Intergenic
1149377163 17:56056102-56056124 TAATATATCCAGAATCTACAAGG - Intergenic
1153206863 18:2712544-2712566 TCATATACACAGGTTCTGCAGGG + Intronic
1156896118 18:42247819-42247841 TCATTCATGTAGAGTCTGCATGG - Intergenic
1157411406 18:47466044-47466066 TCATGTATGCAGCTCCTGCTTGG + Intergenic
1158400394 18:57116538-57116560 TCATTTGAGCAGATTCAGCATGG + Intergenic
1158792880 18:60803493-60803515 TCTAATATCCAGAATCTGCAAGG + Intergenic
1159156287 18:64587517-64587539 TCCTAAATGCTGATTCTCCAAGG + Intergenic
1159500300 18:69260226-69260248 GTATATTTGCAGATTCTACATGG - Intergenic
1159632785 18:70768275-70768297 TCTTATATCCAGAATCTACAAGG + Intergenic
1162191956 19:8953912-8953934 TCATTTTTGCAGATTCTGTCAGG + Exonic
1163503498 19:17689556-17689578 TCATAAATGCAGAATGTGCATGG + Intergenic
1164550485 19:29207184-29207206 TCAGGGACGCAGATTCTGCACGG - Exonic
1168216471 19:54929750-54929772 ACATATATTCAGTTTCTGGAGGG + Intronic
1202676375 1_KI270711v1_random:10533-10555 TCAAATACTCAGATTCTTCATGG + Intergenic
925007479 2:455267-455289 TCACACAAGCAGGTTCTGCAGGG - Intergenic
925053825 2:839831-839853 TCTAATATCCAGAATCTGCAAGG + Intergenic
925568473 2:5283123-5283145 TCCTATATGCAGAAGCTGGAAGG + Intergenic
927006635 2:18857164-18857186 TCTAATATCCAGAATCTGCAAGG - Intergenic
927045945 2:19278452-19278474 TCTAATATCCAGAGTCTGCAAGG - Intergenic
927069604 2:19513298-19513320 TCTTCTATGCTGATTTTGCAAGG + Intergenic
928282437 2:29960550-29960572 TCTAATATCCAGAATCTGCAAGG + Intergenic
928402787 2:30991357-30991379 TCCTATCTGCAGTTTCTGCTCGG + Intronic
929147929 2:38722721-38722743 TCATATATGCAGATAAACCAAGG + Intronic
929165069 2:38874012-38874034 TCCTCTATGCAGGTTCTACAGGG - Intronic
929207939 2:39319445-39319467 TCATATATGTGGGTTTTGCAGGG + Intronic
929214240 2:39393796-39393818 TCATATACACAGGTTCTGCAGGG - Intronic
929636954 2:43533001-43533023 TCTAATATCCAGAATCTGCAAGG + Intronic
929727734 2:44448175-44448197 TCATATATGCAGTTTCTGCAGGG - Intronic
930149278 2:48041939-48041961 TCTGATATCCAGAGTCTGCAAGG - Intergenic
930289136 2:49471456-49471478 TCATATACGCAGGCTCTGAAGGG + Intergenic
930855686 2:56015444-56015466 CCATGTGTGCAGATTTTGCAGGG + Intergenic
932085215 2:68751673-68751695 GCATATAGGCAGATTCTCAAAGG + Intronic
932115931 2:69047113-69047135 TAGTATATGCAGGTTCTGCAGGG + Intronic
932269275 2:70395188-70395210 TCTAATATCCAGAGTCTGCAAGG - Intergenic
932880203 2:75494264-75494286 TCAAATATGTGGCTTCTGCAGGG + Intronic
933462448 2:82605813-82605835 TCATATATGCACACACTTCAAGG - Intergenic
935169148 2:100597056-100597078 TCGTATAGGCAGGTTCTGCAGGG - Intergenic
935728478 2:106044968-106044990 TCATTTTTGCAGTTTTTGCACGG - Intergenic
936363134 2:111825404-111825426 ACCCATATGCAGGTTCTGCAGGG - Intronic
936378666 2:111964948-111964970 TCATTTATTCAGATCCTGAATGG - Intronic
936846069 2:116835034-116835056 TTTTATATGCGGGTTCTGCAGGG - Intergenic
937058495 2:118961596-118961618 TCTAATATTCAGAATCTGCAAGG - Intronic
937523400 2:122738390-122738412 TCATATGTGTAGATTCAGCTGGG + Intergenic
938136365 2:128761072-128761094 TCTAATATGCAGAGTCTACAAGG - Intergenic
939179664 2:138789475-138789497 TCTAATATTCAGAGTCTGCAAGG - Intergenic
939579324 2:143929803-143929825 TCATATATGCATAAACTGCAGGG - Intergenic
941875637 2:170430095-170430117 TCATATATGTGGGTTCTTCAGGG + Intronic
942557655 2:177188442-177188464 TCAAATATGCAGCTTCCACAAGG + Intergenic
942624517 2:177885367-177885389 TCATATCTGTGGGTTCTGCAGGG + Intronic
943316269 2:186392062-186392084 TCAAATATTCAGAATCTACAAGG + Intergenic
943477441 2:188375957-188375979 TCATATATACGGGTTCCGCATGG - Intronic
943597438 2:189875358-189875380 TCATATATGTGGGTTCTGGAGGG - Intronic
943627329 2:190215307-190215329 TCCTAAATGCAGATCCTGGATGG + Intronic
944027077 2:195183205-195183227 TCATATAGGCAGTTTCTGCCTGG + Intergenic
944524613 2:200605864-200605886 TCTAATATCCAGAATCTGCAAGG - Intronic
945381942 2:209150687-209150709 TTATATAAGCACATTCTTCAAGG + Intergenic
946071199 2:217035721-217035743 TCATTTTGGGAGATTCTGCAGGG - Intergenic
947079472 2:226380208-226380230 TGAGAAATGCAGATTCTGCCAGG - Intergenic
947108260 2:226690779-226690801 TTTAATATCCAGATTCTGCATGG - Intergenic
948418934 2:237840687-237840709 TCTAATATGCAGAATCTGTAAGG + Intronic
1170766654 20:19295185-19295207 TCTAATATCCAGATTCTACAAGG - Intronic
1172695350 20:36818691-36818713 TTATACAAGCAAATTCTGCATGG + Intronic
1174491379 20:50899133-50899155 TGGTATATGCAGGTTCTCCAGGG + Intronic
1174968589 20:55248212-55248234 TCAAATATCCAGAATCTACAAGG + Intergenic
1174985432 20:55446582-55446604 TCATATACGCACATTATTCAGGG + Intergenic
1175859089 20:62140202-62140224 TTAAAAATCCAGATTCTGCACGG - Intronic
1177122757 21:17158288-17158310 TTATATATACAGATTCCACAGGG + Intergenic
1177490764 21:21823166-21823188 TCTAATATCCAGAATCTGCAAGG - Intergenic
1178591432 21:33914238-33914260 TCATATTTAAAGATTATGCATGG + Intronic
1178692512 21:34761349-34761371 TCATGCATGCAGCTCCTGCAAGG + Intergenic
1179261421 21:39761524-39761546 TCTAATATCCAGAATCTGCAAGG + Intronic
1179339298 21:40489412-40489434 TGATAAATCCAGAATCTGCAGGG - Intronic
1181561633 22:23706580-23706602 TCTAATATGCAGAATCTACAAGG + Intergenic
1182382623 22:29905225-29905247 TCATATAGGCAGGTTCCACAGGG - Intronic
1183008204 22:34921338-34921360 TCTAATATCCAGAATCTGCAAGG + Intergenic
1183766091 22:39876456-39876478 TCAGGGACGCAGATTCTGCAAGG + Intronic
950535114 3:13574209-13574231 TCACACACGCAGGTTCTGCAGGG - Intronic
950841521 3:15972990-15973012 TCATATATGCATGTTCCTCAGGG + Intergenic
951082179 3:18465713-18465735 TCTTCTATGCGGATTCAGCAGGG + Intergenic
952558313 3:34559181-34559203 TTATATGTCCAGATTCTGAATGG - Intergenic
954229315 3:49204328-49204350 TCATATATACTAGTTCTGCAGGG + Intronic
954782099 3:53069482-53069504 GGATATAAGCAGATTCTTCATGG + Intronic
955425851 3:58788912-58788934 TCATATATGTGGGTTCTGCATGG - Intronic
956005482 3:64774341-64774363 TCATGTATGTGGATTCTGCAGGG + Intergenic
956234464 3:67053278-67053300 TCAAATATCCAGAATCTACAAGG - Intergenic
956317998 3:67961105-67961127 TCTAATATCCAGATTCTACAAGG + Intergenic
956489635 3:69757010-69757032 TCTAATATCCAGATTCTACAAGG - Intronic
956677318 3:71748287-71748309 TCATATATATGGGTTCTGCAGGG + Intronic
957518711 3:81290871-81290893 TCACATATGAAGGTTCTGCAGGG - Intergenic
957698689 3:83680364-83680386 TCTAATATGCAGAATCTACAAGG + Intergenic
958882695 3:99691057-99691079 TCCTGTATGCAAGTTCTGCAGGG + Intronic
959047196 3:101487350-101487372 TCTAATATCCAGATTCTGTAAGG - Intronic
959365499 3:105452951-105452973 TCTAATATCCAGAATCTGCAAGG - Intronic
959956310 3:112242208-112242230 TCTTATATCCAGAATCTACAAGG + Intronic
960085409 3:113585169-113585191 TCACATAAACAGATTCTGAAGGG - Exonic
961983609 3:131107615-131107637 GTATATATGAAGGTTCTGCAGGG - Intronic
962861039 3:139401908-139401930 TCAAATATCCAGAATCTACAAGG - Intergenic
963190028 3:142459709-142459731 TCATACATGCAGGTTCTGCAGGG + Intronic
964365897 3:155950635-155950657 TCATATACCCAGATTCTTCAGGG + Intergenic
964423550 3:156529889-156529911 TCATAGATGCAGTGTCTGCTGGG - Intronic
964640323 3:158903084-158903106 TCATATATAGATATTCTGAATGG + Intergenic
965803783 3:172521311-172521333 TCTAATATGCAGAATCTACAAGG + Intronic
968532663 4:1102345-1102367 TCCTGTATGCAGGTTCTACAAGG - Intronic
969693517 4:8721662-8721684 TCAAAACTGCAGATTCAGCAAGG + Intergenic
970490496 4:16568676-16568698 TCTTATCTGTAGGTTCTGCAGGG - Intronic
971422621 4:26488091-26488113 TCAGTTCTGCATATTCTGCAAGG + Intronic
971919150 4:32914158-32914180 TCTAATATCCAGATTCTACAAGG + Intergenic
972454111 4:39235746-39235768 GCAAATATCCAGAATCTGCAAGG + Intronic
972919516 4:43920873-43920895 TCTAATATCCAGAATCTGCAAGG + Intergenic
973932906 4:55810877-55810899 TCAAATATCCAGAATCTACAAGG - Intergenic
975022920 4:69512962-69512984 TCTCATATCCAGATTCTACAAGG - Intronic
975286669 4:72629328-72629350 TCTCATTTGCAGATTCTGCTAGG + Intergenic
975464353 4:74692723-74692745 TCATATCTGTGGGTTCTGCATGG - Intergenic
975499803 4:75072081-75072103 TCACATACCCAGATTCTGCATGG - Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
976145523 4:82039415-82039437 CCATATATGCAGATTCAACAGGG - Intronic
976321933 4:83726077-83726099 TCAAATATTAAGATTCTACAAGG - Intergenic
978518353 4:109593523-109593545 TCATACATGCAGATACAGAAAGG - Intronic
978566614 4:110089393-110089415 TCATATATGTAGGTTCCTCAGGG + Intronic
979527279 4:121730490-121730512 TCTAATATCCAGAATCTGCAAGG - Intergenic
980192700 4:129544986-129545008 TCATAGATGAAGATTCTTCATGG + Intergenic
980660294 4:135849154-135849176 TCAGATATCCAGAATCTACAAGG + Intergenic
980999734 4:139817350-139817372 TCATCCATGCAAATTCTGCCAGG + Intronic
982084955 4:151825061-151825083 TCATCTAGGCACATTCTGAAAGG + Intergenic
982704713 4:158694957-158694979 TCATATATGTGAGTTCTGCAGGG - Intronic
982905377 4:161062399-161062421 TCATATTTTCAGAATCTCCAGGG - Intergenic
982971305 4:161991661-161991683 TCATATATGCAGTTTCCACAGGG + Intronic
983315661 4:166129773-166129795 TCTAATATGCAGAATCTACAAGG - Intergenic
984196259 4:176661172-176661194 TCATGAATGCTGATTCTGCTTGG - Intergenic
985038197 4:185862274-185862296 GCACACAGGCAGATTCTGCAGGG + Intronic
985092095 4:186373858-186373880 TTATATAAGCAGAATCTGTACGG + Intergenic
985143626 4:186869771-186869793 TCATATTTACAGATTTTTCAGGG + Intergenic
985885340 5:2673162-2673184 TCAGATATGCACAGGCTGCAGGG - Intergenic
986121594 5:4842729-4842751 TCATATATGCATATAGTGCCTGG - Intergenic
986173300 5:5331251-5331273 TCCTACAGGCAGGTTCTGCATGG + Intergenic
986270532 5:6227001-6227023 TGATAAATCCAAATTCTGCAAGG + Intergenic
986917760 5:12644101-12644123 ACTAATATCCAGATTCTGCAAGG + Intergenic
987431307 5:17837052-17837074 TCTAATATGCAGAGTCTACAAGG - Intergenic
987959568 5:24787936-24787958 TCATTTATGCAGATACTGTAAGG + Intergenic
988207206 5:28154212-28154234 TCATTTGTGCAGATTCTGATGGG + Intergenic
989268933 5:39509292-39509314 TCATATATCCAGCTCCTGCCTGG + Intergenic
989324149 5:40170981-40171003 TAATATATCCAGAATCTGTAGGG + Intergenic
990003412 5:50921371-50921393 TCCTAAATGAAGAGTCTGCAAGG + Intergenic
990997269 5:61745337-61745359 GCATATCTGCAGTTTGTGCAGGG + Intronic
991985050 5:72276677-72276699 TCTAATATCCAGAGTCTGCAAGG + Intronic
992263879 5:74998047-74998069 TCATATATGTGGGTTCTGCAGGG - Intergenic
992520045 5:77541215-77541237 TCTAATATGCAGAGTCTACAAGG + Intronic
992754542 5:79891870-79891892 TCCTATATGCTTGTTCTGCAGGG - Intergenic
993970413 5:94412897-94412919 GCATATATGCAGGTTCTGTGGGG + Intronic
994228085 5:97277482-97277504 TCTAATATCCAGAGTCTGCAAGG + Intergenic
994271056 5:97777507-97777529 TCTAATATCCAGAATCTGCAAGG + Intergenic
994329444 5:98488522-98488544 TAATCTATCCAGTTTCTGCAGGG - Intergenic
994404247 5:99323981-99324003 TCTAATATCCAGAATCTGCAAGG + Intergenic
994607719 5:101991043-101991065 ACATTTATGGAGATTCTACATGG + Intergenic
995340455 5:111052990-111053012 TCTTATATCCAGAATCTACAAGG - Intergenic
995405530 5:111790930-111790952 TCATATATGTGGGTTCAGCAGGG + Intronic
996215542 5:120860847-120860869 TTATATATGTGGGTTCTGCAGGG + Intergenic
996878610 5:128267699-128267721 TCTAATATCCAGAATCTGCAAGG - Intronic
997085510 5:130793070-130793092 TCAAATATCCAGAATCTACAAGG + Intergenic
999408652 5:151329941-151329963 TCATATACTCAGGTTCTGCAGGG + Intronic
999773311 5:154791716-154791738 TCATATATGTAGGTCCTGCAGGG - Intronic
1000921890 5:167147962-167147984 TCATACATCCTCATTCTGCATGG - Intergenic
1001134493 5:169091227-169091249 TCATCTAGGCAGACTCTACACGG + Intronic
1001361682 5:171091936-171091958 TCATATATGCAGGTTCCACAGGG + Intronic
1001378288 5:171283533-171283555 TCAAATCTGAAAATTCTGCATGG + Intronic
1002938015 6:1690621-1690643 TCTAATATGCAGAGTCTACACGG + Intronic
1003465608 6:6377055-6377077 TCCTATATACAGATTCTGTGTGG - Intergenic
1004486717 6:16073128-16073150 TCATATATGCAGGTTCCTCAGGG - Intergenic
1004760579 6:18661637-18661659 TCTTATATCCAGAATTTGCAAGG + Intergenic
1006552126 6:34833205-34833227 TCATATATGCAGGTCCCTCAGGG + Intronic
1006564641 6:34944669-34944691 TCATATGTGCAGATTCTGTGGGG - Intronic
1006627510 6:35407743-35407765 TAATATATTCAGACTCGGCATGG - Intronic
1006724338 6:36186024-36186046 TCTTGTATGCAGATCCTTCAAGG - Intergenic
1006765629 6:36503081-36503103 TCACATGTGCAGTTTCTCCAGGG + Intronic
1008250051 6:49228610-49228632 TCTAATATGCAGAATCTACAAGG + Intergenic
1009777760 6:68227202-68227224 TCATCTATGTAGCTTCTTCATGG + Intergenic
1010168331 6:72943226-72943248 ATATTTATGCAGATTCTGTATGG - Intronic
1011667205 6:89646079-89646101 TCATGTATGCGGGTTCTCCAGGG - Intronic
1014624697 6:123711241-123711263 TCTGATAAGCAGATTCTGGATGG - Intergenic
1016197964 6:141368903-141368925 TCTAATATTCAGAGTCTGCAAGG - Intergenic
1016998830 6:149981153-149981175 TCTAATATGCAGAATCTACAAGG + Intergenic
1018510842 6:164522650-164522672 TCTAATATCCAGAATCTGCAAGG - Intergenic
1018806319 6:167263868-167263890 TCAAATATCCAGAATCTACAAGG + Intergenic
1019218016 6:170455928-170455950 TCATCTACACAGATTCTGTAGGG - Intergenic
1021661385 7:22921747-22921769 TTGTATATGCAGGTTCTGCAAGG - Intergenic
1023329433 7:39099070-39099092 TCATAAATGGAGGTTCTACAGGG + Intronic
1023397591 7:39765680-39765702 TGATATAGGCAGATCCTTCATGG + Intergenic
1023550456 7:41364817-41364839 TCTAATATCCAGAATCTGCAAGG + Intergenic
1025173479 7:56782617-56782639 TCATATATCCAGGTTTTGCAGGG + Intergenic
1025698624 7:63795554-63795576 TCATATATCCAGGTTCTGCAGGG - Intergenic
1025973491 7:66350326-66350348 TCTTATATGTAGATTCTTTAGGG + Intronic
1026073025 7:67139568-67139590 TCATATCTGTGGGTTCTGCAGGG - Intronic
1026703860 7:72672648-72672670 TCATATCTGTGGGTTCTGCAGGG + Intronic
1027276142 7:76558600-76558622 CCAAATTTGCAGCTTCTGCAAGG + Intergenic
1028161120 7:87485421-87485443 TCAAATATCCAGAATCTACAAGG + Intergenic
1028854782 7:95578189-95578211 TGATAAATGAAGATTCTGCCTGG + Intergenic
1028859271 7:95629878-95629900 TCAGATATTCAGATTCTTTAGGG - Intergenic
1030087280 7:105827595-105827617 TCATATATTCGGGTTCCGCAAGG + Intronic
1030203090 7:106925558-106925580 TCATGTATCCAGGTTCTGCAAGG + Intergenic
1030413341 7:109210369-109210391 TCAAATATCCAGAGTCTACAAGG - Intergenic
1032607701 7:133374474-133374496 TCATACAGGCAGCTTCTCCAAGG - Intronic
1032644468 7:133807092-133807114 TCATATACGCAGGTTCTGCAGGG + Intronic
1032987020 7:137348739-137348761 TCATATTTACAGATTAAGCAGGG + Intergenic
1032989245 7:137373280-137373302 TAATATATCCACAGTCTGCAAGG - Intergenic
1033025627 7:137769588-137769610 TCTAATATGCAGAATCTACAAGG + Intronic
1033565378 7:142573636-142573658 TCTAATATCCAGAGTCTGCAAGG + Intergenic
1033690362 7:143730481-143730503 TCTGATATCCAGAATCTGCAAGG - Intergenic
1034507414 7:151504428-151504450 TCATATATGCAGATTCTGCAGGG - Intronic
1034963889 7:155379617-155379639 TCACATATGCAGAGTCTGAAAGG + Intergenic
1034999208 7:155598167-155598189 TCTTAGATGCAAATTTTGCATGG - Intergenic
1037447908 8:18986203-18986225 TCATTAATGCAGTTTCTCCAGGG - Intronic
1037655971 8:20884551-20884573 CCACATATTCAGATTCTTCAGGG - Intergenic
1038095349 8:24303021-24303043 TCAAATATGCAGAATCTACAAGG - Intronic
1038514860 8:28179112-28179134 TCATAGACGCAGCTTCTGCAGGG + Intronic
1039122190 8:34159482-34159504 CCATGTCTGCAGGTTCTGCATGG - Intergenic
1039155509 8:34552274-34552296 TCTAATATTCAGATTCTTCAGGG - Intergenic
1040045145 8:42955274-42955296 TCACATAGGGAGGTTCTGCAGGG + Intronic
1041887063 8:62822436-62822458 ACATACATGCTGATTTTGCATGG + Intronic
1041911317 8:63091557-63091579 TCTAATATCCAGAATCTGCAAGG + Intergenic
1042015882 8:64310554-64310576 ACAAATATCCAGAATCTGCAAGG + Intergenic
1044632695 8:94294756-94294778 TCTAATATGCAGAATCTACAAGG + Intergenic
1044701696 8:94971045-94971067 TCATAGATGCAAACTCTTCAAGG - Intronic
1046548847 8:115686479-115686501 CCACACATCCAGATTCTGCAAGG + Intronic
1046662076 8:116958771-116958793 ACATATAAGTAGATTCTCCAAGG - Intronic
1046728141 8:117696235-117696257 TCATATATGCAGATTTTCCTTGG - Intergenic
1046823697 8:118663458-118663480 CCATATATAGAGATACTGCAAGG + Intergenic
1048566560 8:135605637-135605659 TCAAATATGTATGTTCTGCAGGG - Intronic
1049050000 8:140187234-140187256 TCATATACACAGGTTCTGCAAGG + Intronic
1049085486 8:140475177-140475199 TCTTATATCCAGAATCTACAAGG - Intergenic
1049837029 8:144742851-144742873 TCATATAAGTGGATTCTGAAAGG - Intronic
1049946323 9:599761-599783 TCATATACGCAGGTTCTTCAGGG + Intronic
1050007984 9:1154535-1154557 TCAAATATGTAGGTTCTGCAGGG - Intergenic
1050775188 9:9250910-9250932 ACATAGATGCAAATTCAGCAAGG + Intronic
1051546223 9:18279223-18279245 TTATACATGTAGGTTCTGCAGGG - Intergenic
1051726419 9:20091395-20091417 TCATATAATCAGATTTTCCAAGG + Intergenic
1055133105 9:72797980-72798002 TCTAATATGCAGAGTCTACAAGG + Intronic
1056619085 9:88195480-88195502 GCATCTGTGCAGAATCTGCACGG - Intergenic
1057158408 9:92866254-92866276 TCTAATATCCAGATTCTACAGGG + Intronic
1059124872 9:111674866-111674888 TCATATACACAGGTTCTGCAGGG - Intergenic
1059374003 9:113867491-113867513 TCAAATATCCAGATTCCGCCTGG + Intergenic
1060338800 9:122753866-122753888 TCAAATATCCAGAATCTACAAGG - Intergenic
1185788894 X:2913544-2913566 AGATATGTTCAGATTCTGCAAGG + Intronic
1186318043 X:8392261-8392283 TCAAATATCCAGAATCTACAAGG - Intergenic
1186523393 X:10225473-10225495 TCTAATATGCAGAATCTACAAGG - Intronic
1186925325 X:14327402-14327424 TCATACAGGCAGGTTCTGCAGGG + Intergenic
1186974214 X:14882854-14882876 TCATATATCCTCATTCTGAATGG + Intronic
1187634069 X:21207008-21207030 TCTTATATACAGAATCTGTAAGG + Intergenic
1188501143 X:30827790-30827812 TAATACAAGTAGATTCTGCATGG - Exonic
1188724885 X:33570681-33570703 TTGTATATGCAGCTCCTGCAGGG - Intergenic
1189274082 X:39772238-39772260 ACAGAGTTGCAGATTCTGCAAGG - Intergenic
1189836481 X:45028419-45028441 TCATATAGTCAGATTTTGCTTGG + Intronic
1190390908 X:49930687-49930709 TCCTATATGCAGGTTCTGTAAGG - Intronic
1190474835 X:50815548-50815570 TCATATATGCAGACAGTCCAGGG - Intergenic
1190838731 X:54126448-54126470 TCATATACACAGGTTCTGCAGGG + Intronic
1191884009 X:65871319-65871341 TCTAATATCCAGAGTCTGCAAGG - Intergenic
1192348239 X:70330911-70330933 TTATACATGTGGATTCTGCAGGG + Intronic
1192591619 X:72364769-72364791 TCTTATATGCATATATTGCATGG - Intronic
1193746720 X:85290819-85290841 TCTAATATGCAGAATCTGTAAGG - Intronic
1194152329 X:90341081-90341103 TCTAATATCCAGATTCTACAAGG - Intergenic
1194287260 X:92025238-92025260 TCTAATATCCAGAATCTGCAAGG + Intronic
1194536524 X:95111105-95111127 TTGTATATGCAGGTTCTTCAGGG + Intergenic
1194548019 X:95262176-95262198 TCTAATATGCAGAATCTACAAGG + Intergenic
1195249927 X:103032987-103033009 TCTAATATCCAGATTCTACAAGG + Intergenic
1196094143 X:111780583-111780605 TTGTATCTGCAGGTTCTGCAGGG - Intronic
1196232285 X:113238221-113238243 TCTAATATCCAGAATCTGCAAGG - Intergenic
1196517762 X:116633323-116633345 TCTAATATCCAGAATCTGCAAGG + Intergenic
1197361463 X:125509052-125509074 TCATGTCTACAGGTTCTGCAGGG + Intergenic
1197964974 X:132050492-132050514 TCATATATGTGGGTTCCGCAGGG - Intergenic
1198833403 X:140776041-140776063 TCTAATATCCAGAATCTGCAAGG + Intergenic
1199401931 X:147408640-147408662 TCTTATATCCAGAATCTACAAGG + Intergenic
1200305365 X:155020477-155020499 TCATATCTTCAGAGTCGGCAAGG - Intronic
1200498675 Y:3917838-3917860 TCTAATATCCAGATTCTACAAGG - Intergenic
1200604797 Y:5249807-5249829 TCTAATATCCAGAATCTGCAAGG + Intronic
1200793715 Y:7321697-7321719 TAAAATTTGCAGATTCTGCAAGG - Intergenic
1200935251 Y:8732795-8732817 TCATACAGGCAGAATCTGCATGG + Intergenic
1201286078 Y:12379821-12379843 AGATATGTTCAGATTCTGCAAGG - Intergenic