ID: 1034507621

View in Genome Browser
Species Human (GRCh38)
Location 7:151506853-151506875
Sequence GCTGGTGGTGCTACACAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034507619_1034507621 -9 Left 1034507619 7:151506839-151506861 CCTTTATCTGGTGGGCTGGTGGT 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1034507621 7:151506853-151506875 GCTGGTGGTGCTACACAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034507621 Original CRISPR GCTGGTGGTGCTACACAGCT GGG Intronic
No off target data available for this crispr