ID: 1034508939

View in Genome Browser
Species Human (GRCh38)
Location 7:151519256-151519278
Sequence GGTGGAGGAGCCGCGGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034508939_1034508953 24 Left 1034508939 7:151519256-151519278 CCAGCTACCGCGGCTCCTCCACC 0: 1
1: 0
2: 3
3: 20
4: 237
Right 1034508953 7:151519303-151519325 ACCACCTCCGCTCAGAATGGTGG 0: 1
1: 0
2: 0
3: 6
4: 85
1034508939_1034508951 21 Left 1034508939 7:151519256-151519278 CCAGCTACCGCGGCTCCTCCACC 0: 1
1: 0
2: 3
3: 20
4: 237
Right 1034508951 7:151519300-151519322 GCCACCACCTCCGCTCAGAATGG 0: 1
1: 0
2: 1
3: 10
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034508939 Original CRISPR GGTGGAGGAGCCGCGGTAGC TGG (reversed) Intronic