ID: 1034509177

View in Genome Browser
Species Human (GRCh38)
Location 7:151520173-151520195
Sequence CCCCGCCCTGCGCTCCGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034509177_1034509188 26 Left 1034509177 7:151520173-151520195 CCAGAACGGAGCGCAGGGCGGGG No data
Right 1034509188 7:151520222-151520244 CGAAACGCTAAGCGGTTGGCGGG No data
1034509177_1034509184 3 Left 1034509177 7:151520173-151520195 CCAGAACGGAGCGCAGGGCGGGG No data
Right 1034509184 7:151520199-151520221 TAGGTGGGAGGTGCGGTGATTGG No data
1034509177_1034509183 -4 Left 1034509177 7:151520173-151520195 CCAGAACGGAGCGCAGGGCGGGG No data
Right 1034509183 7:151520192-151520214 GGGGCAATAGGTGGGAGGTGCGG No data
1034509177_1034509182 -9 Left 1034509177 7:151520173-151520195 CCAGAACGGAGCGCAGGGCGGGG No data
Right 1034509182 7:151520187-151520209 AGGGCGGGGCAATAGGTGGGAGG No data
1034509177_1034509185 18 Left 1034509177 7:151520173-151520195 CCAGAACGGAGCGCAGGGCGGGG No data
Right 1034509185 7:151520214-151520236 GTGATTGGCGAAACGCTAAGCGG No data
1034509177_1034509186 22 Left 1034509177 7:151520173-151520195 CCAGAACGGAGCGCAGGGCGGGG No data
Right 1034509186 7:151520218-151520240 TTGGCGAAACGCTAAGCGGTTGG No data
1034509177_1034509187 25 Left 1034509177 7:151520173-151520195 CCAGAACGGAGCGCAGGGCGGGG No data
Right 1034509187 7:151520221-151520243 GCGAAACGCTAAGCGGTTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034509177 Original CRISPR CCCCGCCCTGCGCTCCGTTC TGG (reversed) Intergenic
No off target data available for this crispr