ID: 1034509216

View in Genome Browser
Species Human (GRCh38)
Location 7:151520375-151520397
Sequence TGGTGACTAAGCGTCACCGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034509211_1034509216 20 Left 1034509211 7:151520332-151520354 CCTTGAGCTGCGTTAGCGTTCGT No data
Right 1034509216 7:151520375-151520397 TGGTGACTAAGCGTCACCGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034509216 Original CRISPR TGGTGACTAAGCGTCACCGA CGG Intergenic
No off target data available for this crispr