ID: 1034510023

View in Genome Browser
Species Human (GRCh38)
Location 7:151526433-151526455
Sequence AAGAAACAAGATTGTCGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034510023_1034510027 17 Left 1034510023 7:151526433-151526455 CCTGGTCGACAATCTTGTTTCTT No data
Right 1034510027 7:151526473-151526495 CCACTTCCCCCATCCACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034510023 Original CRISPR AAGAAACAAGATTGTCGACC AGG (reversed) Intergenic
No off target data available for this crispr