ID: 1034514044

View in Genome Browser
Species Human (GRCh38)
Location 7:151559891-151559913
Sequence CACACTCAGTAGTAAGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034514044_1034514048 -7 Left 1034514044 7:151559891-151559913 CCCACCTCTTACTACTGAGTGTG 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1034514048 7:151559907-151559929 GAGTGTGTGAAATGAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034514044 Original CRISPR CACACTCAGTAGTAAGAGGT GGG (reversed) Intronic
900293587 1:1936792-1936814 CACACTCAGGAGGCTGAGGTGGG + Intronic
900588246 1:3444282-3444304 CACACTCAGTAATAAGAAAGTGG - Intergenic
904296620 1:29523524-29523546 CACACACAGCAGGAAGAGGTGGG - Intergenic
904329697 1:29750437-29750459 CCCACTCTGGAGTAAGAGCTTGG - Intergenic
904463514 1:30694286-30694308 CACACACAGCAGGAAGGGGTGGG + Intergenic
904992741 1:34606802-34606824 AATACTCAGTAGAAGGAGGTGGG - Intergenic
905626400 1:39492575-39492597 CACACCCAGGAGTAAGAATTAGG + Intronic
905974763 1:42166098-42166120 CACACTCACCAGAAAGGGGTGGG - Intergenic
907760059 1:57348925-57348947 CTCCCACAGAAGTAAGAGGTGGG + Intronic
908115680 1:60937740-60937762 CACACTGATTAGGAAGAGCTGGG - Intronic
908812505 1:67997983-67998005 CATGCTGAGGAGTAAGAGGTAGG + Intergenic
914387826 1:147188928-147188950 CAAACTCAGTAGTGAGAAGAAGG + Intronic
916422022 1:164646534-164646556 CACAATTAGAAGTAAGGGGTCGG - Intronic
923385476 1:233461591-233461613 TAGACTCAGTATTCAGAGGTAGG + Intergenic
923407639 1:233678617-233678639 CACACTCAGGAGGCTGAGGTGGG + Intergenic
923861432 1:237895757-237895779 CACATTGAGTAGGAAGAGGAGGG + Intergenic
924118555 1:240772468-240772490 CACACTCATTACGAAGAGGGAGG + Intergenic
924674645 1:246163803-246163825 CACACTCAGTTGTATGCAGTGGG - Intronic
1063928907 10:11009509-11009531 CACACTCAGAAGAAAGCTGTGGG - Intronic
1065105051 10:22374913-22374935 TACATGCAGTAGTAAGAGGAAGG + Intronic
1069386956 10:67892459-67892481 TCCACTCAGTAGTCTGAGGTGGG + Intronic
1078014682 11:7602942-7602964 AACTCTGAGAAGTAAGAGGTAGG - Intronic
1078083894 11:8222428-8222450 CAAACTCTGAAGTAAGAGTTGGG + Intergenic
1079138752 11:17793530-17793552 CTCACACAGAAGTAAGAGGAAGG + Intronic
1080420917 11:32109799-32109821 CTCTCACAGTATTAAGAGGTGGG + Intergenic
1080528241 11:33148582-33148604 CACACTCAGGAGGCTGAGGTGGG + Intronic
1080543625 11:33294437-33294459 CACACCCTGTAGGAAAAGGTAGG - Intronic
1083251899 11:61473847-61473869 CAGTCTGAGTAGTTAGAGGTGGG - Intronic
1085071047 11:73546043-73546065 TATGCTCAGTAGTAAGAAGTGGG - Intronic
1085425609 11:76402076-76402098 CACACTAAGGAGTAGGAGATAGG - Intronic
1086578586 11:88369839-88369861 TAGACTCAGGAGAAAGAGGTTGG - Intergenic
1087917510 11:103828406-103828428 CACACACAAGGGTAAGAGGTTGG + Intergenic
1091784223 12:3232617-3232639 CAAACTCAGTCGCTAGAGGTAGG - Intronic
1092668669 12:10836955-10836977 CCCACTCAGTTTTAAGAGGAAGG - Intronic
1094191823 12:27705893-27705915 CAGACTCAGTTGGTAGAGGTGGG - Intergenic
1099048461 12:77753641-77753663 CACAGTCAGTAGAAAAAGGAGGG + Intergenic
1099211816 12:79800302-79800324 CACACTGAGGAGGAAGAGGAGGG - Intronic
1100932719 12:99628888-99628910 CCCATTAAGTATTAAGAGGTGGG - Intronic
1102816108 12:115867782-115867804 CACTCCCTGTAGTAGGAGGTTGG + Intergenic
1104473769 12:129053465-129053487 CACACTCAGTAGAATGCTGTTGG - Intergenic
1109099097 13:58156958-58156980 CACATTCAGAATTAAGAGTTGGG + Intergenic
1109104415 13:58232941-58232963 CACACTTAGTAGTCAGATCTTGG + Intergenic
1110409071 13:75184297-75184319 CACACTCAGTACTAATCAGTAGG + Intergenic
1111215813 13:85139865-85139887 CACAGTCAGTAATAAGAGGAGGG - Intergenic
1114575803 14:23711992-23712014 CAAACTCAGTAGAAAGATCTAGG - Intergenic
1117535996 14:56704028-56704050 CACCCTGAGTAGTAGGAGGATGG + Intronic
1121217237 14:92257996-92258018 CACACTCAGGAGGCAAAGGTGGG + Intergenic
1123020744 14:105396830-105396852 CACACTCAGTAGGGAGATGAAGG + Exonic
1124425543 15:29559684-29559706 CTGAGTCAGTAGTAGGAGGTGGG - Intronic
1124430985 15:29608424-29608446 CACACTCAGGAGAAAGCGCTGGG - Intergenic
1127890250 15:63244055-63244077 GATACTAAGTACTAAGAGGTGGG - Intronic
1132714495 16:1284027-1284049 CAGATTCAGTGGGAAGAGGTGGG - Intergenic
1134681240 16:16127316-16127338 GACACTCAGGAGGCAGAGGTAGG - Intronic
1135209278 16:20510412-20510434 CAAGCTCTGTAGTAGGAGGTGGG - Intergenic
1136493955 16:30630094-30630116 CACACACAGTAGCACGAGTTGGG - Intergenic
1137474645 16:48797150-48797172 TCCACTCAGTAGTTAGAGTTTGG - Intergenic
1144261036 17:13521109-13521131 CAAACTCAGAAGCAAGAGTTTGG - Intronic
1147266312 17:39236934-39236956 CAAACACAGTAGTAGGAGGTGGG + Intergenic
1147652176 17:42068951-42068973 CACCCTGGGTAGAAAGAGGTGGG + Intergenic
1154022501 18:10676766-10676788 CACCCTCAGTGGAAAGAGGTGGG - Intronic
1157729669 18:49992610-49992632 CATCCTCAGGAGTAAGAGGCTGG - Intronic
1159153329 18:64549334-64549356 TAAAATCAGTAGTAAGAGGAAGG - Intergenic
1159789809 18:72764605-72764627 CTCACACAGTAGTCAGAGCTGGG - Intronic
1161108057 19:2454461-2454483 CCCACACACAAGTAAGAGGTGGG + Intronic
1161988976 19:7673209-7673231 CACACACAGCAGTAAGGGGCAGG - Intergenic
1164424946 19:28133005-28133027 CACACTAAGTAGTGAGAAGATGG - Intergenic
928937133 2:36690269-36690291 CACACACAGTATTAAGAGCTTGG - Intergenic
938085041 2:128394130-128394152 CACGTTCAGTAGAAAGTGGTAGG - Intergenic
939206449 2:139110648-139110670 CAAAATCAGTAGTAAGAGGGAGG - Intergenic
940196313 2:151098346-151098368 CTCACTCAATCCTAAGAGGTGGG + Intergenic
940278582 2:151965681-151965703 CTCAATCATTAGTAAGAGTTAGG + Intronic
941501872 2:166289400-166289422 CTCACTCATGAGTGAGAGGTGGG - Intronic
942219829 2:173758220-173758242 GTCACTCAGTTGTAAGTGGTGGG - Intergenic
942311266 2:174659212-174659234 CACACTCAGGAGGCTGAGGTAGG - Intronic
942665407 2:178311809-178311831 CACTCTCAGGAGCAAGAGGAAGG - Intronic
943468806 2:188266133-188266155 CACACTCAATAGAAATAGGAAGG + Intergenic
946195673 2:218032070-218032092 CAGCCTCAGGAGCAAGAGGTTGG - Intergenic
948180398 2:235975007-235975029 CACACTGAGTTGTAAAAGTTAGG + Intronic
1169053882 20:2604001-2604023 CACAGGCAGTAATAAGAGGGAGG + Intronic
1169117462 20:3075003-3075025 CACACTCAGGAGCAACAGGGCGG + Intergenic
1169742051 20:8905475-8905497 CACACTCAGTGGTGGGAGATGGG - Intronic
1173154216 20:40594230-40594252 CACAGTCAGGAGGAAGAGGAAGG + Intergenic
1174190920 20:48739988-48740010 TAAACTCAGTAGTTAGTGGTTGG + Intronic
1174437642 20:50522227-50522249 CACACTCAGTTGCCTGAGGTGGG - Intronic
1176148458 20:63576017-63576039 CACACTCAGGAGTCTGGGGTGGG + Intergenic
1177272087 21:18862513-18862535 AACATTCAGTAGTTAGCGGTAGG + Intergenic
1179484912 21:41704042-41704064 CACACCCAGGCGTGAGAGGTGGG + Intergenic
1181732769 22:24859610-24859632 CATAATCAGAACTAAGAGGTTGG - Intronic
1181791904 22:25274518-25274540 CACATCCTGTAGTAAGAAGTGGG + Intergenic
1182943597 22:34301295-34301317 CACAATCAGTTGGAAGAGGCAGG + Intergenic
951352385 3:21621851-21621873 CACACACAGTGGTAACAGGTTGG - Intronic
952062934 3:29532498-29532520 CACACTTATTTGTAAGAGCTTGG - Intronic
952599898 3:35067462-35067484 CTCACTCAGGAGTATGAGGCAGG - Intergenic
956828523 3:73021481-73021503 AACACTCTGGAGTCAGAGGTGGG - Intronic
957221044 3:77382566-77382588 GAGACTCAGAAGAAAGAGGTTGG - Intronic
961125691 3:124415763-124415785 CACACTGAGTAGCAACATGTTGG - Intronic
963254975 3:143135867-143135889 CACACTCAGTGGTGAGAGCCAGG - Intergenic
965450878 3:168836281-168836303 CACATTCAGTGGAAAGAGATTGG + Intergenic
970902779 4:21178927-21178949 GCCACTCAGTAGGATGAGGTGGG - Intronic
971868753 4:32208309-32208331 CACACCCATCAGCAAGAGGTGGG + Intergenic
976369058 4:84266084-84266106 CTCAGTCAGTTGGAAGAGGTAGG + Intergenic
977335227 4:95689568-95689590 CCCACTCAGCTTTAAGAGGTGGG - Intergenic
977451039 4:97198414-97198436 AAAACTCATTAGTTAGAGGTAGG + Intronic
977611418 4:99036707-99036729 AACACTCAGTAGTAAAAGCCTGG - Intronic
978676516 4:111325575-111325597 CAATCTCTGTGGTAAGAGGTTGG + Intergenic
982596796 4:157395903-157395925 AAAACTCAGCAGTAAGGGGTGGG + Intergenic
989110077 5:37898883-37898905 CACAGGCAGTAGTAAAAGGGGGG + Intergenic
992371463 5:76148559-76148581 GATACTCAGGAGTCAGAGGTGGG - Intronic
997169476 5:131701434-131701456 CACACACAGTAATAAGTTGTGGG - Intronic
997906722 5:137824518-137824540 CCCACTCAGGAGGTAGAGGTGGG - Intergenic
997959445 5:138308094-138308116 CACAGTAGGAAGTAAGAGGTGGG - Intronic
998422578 5:142001227-142001249 CATACTCATTAGTAAGTGGGAGG - Exonic
999210156 5:149881228-149881250 CACACCCAGTAATGAGATGTTGG - Intronic
1008450786 6:51648026-51648048 CAGACTCAGTGCTAAAAGGTAGG - Exonic
1008887029 6:56442624-56442646 CACATTCAGCAGAAAGAAGTAGG + Intergenic
1011332893 6:86229411-86229433 TTTACTCAGTAGTAAGAGATGGG + Intergenic
1012862191 6:104573269-104573291 CACACTGAGTTTTAAAAGGTTGG + Intergenic
1016247990 6:142010141-142010163 TACATTCATTAGTAAGGGGTTGG - Intergenic
1017127323 6:151078328-151078350 CTCACTCAGGAGGATGAGGTAGG + Intronic
1020197025 7:6048601-6048623 CACACTCAGTGGCGAGAGGCAGG + Intronic
1026085742 7:67261529-67261551 GACACTCAGGAGGCAGAGGTGGG + Intergenic
1026501483 7:70946708-70946730 CACACACAGTTGTAGGAGGTAGG + Intergenic
1026691425 7:72553355-72553377 GACACTCAGGAGGCAGAGGTGGG - Intergenic
1034514044 7:151559891-151559913 CACACTCAGTAGTAAGAGGTGGG - Intronic
1036707755 8:11057817-11057839 CTCATTTAGTAGTAAGAGGTAGG - Intronic
1039428778 8:37509270-37509292 AATACTCAGTAATAAGAAGTGGG - Intergenic
1039461934 8:37752292-37752314 CACCCCAAGAAGTAAGAGGTGGG - Intronic
1041933506 8:63311865-63311887 CACACTCAGTCTAAATAGGTAGG + Intergenic
1042934820 8:74048008-74048030 CACACTCAGGAGGCTGAGGTGGG - Intergenic
1043770841 8:84198074-84198096 CACACTCTTTAGTAGGATGTAGG + Intronic
1046631221 8:116624871-116624893 CAGAGTCGGTAGTAAGAGATGGG - Intergenic
1046650711 8:116834092-116834114 CACTCACAGAAGTAAGAGCTCGG - Intronic
1048612925 8:136043218-136043240 CATAATGAGTAGTAAGAGATTGG - Intergenic
1048893306 8:138966701-138966723 AACACTAGGTGGTAAGAGGTGGG + Intergenic
1052125718 9:24772314-24772336 AACAATGAGTATTAAGAGGTTGG - Intergenic
1054915135 9:70488730-70488752 CAGTCTCAGAAGTCAGAGGTTGG + Intergenic
1056257528 9:84815272-84815294 CATAGTCAGTAGTTAGGGGTGGG - Intronic
1057537334 9:95925184-95925206 GACACTCAAGAGAAAGAGGTGGG - Intronic
1058525052 9:105849529-105849551 CTCACTCAGGAGCAAGAGTTTGG + Intergenic
1062079834 9:134618020-134618042 CACACTCAGTAGACAGGGGCTGG - Intergenic
1189716304 X:43870328-43870350 CACACAGAGTGGTAAGAGATTGG + Intronic
1194555264 X:95350575-95350597 CACACTAGGGAGTAAGAGATTGG - Intergenic
1196369876 X:114965449-114965471 CACACAACATAGTAAGAGGTAGG - Intergenic
1196429564 X:115608222-115608244 AACACTCAGTATAGAGAGGTAGG - Intronic