ID: 1034514048

View in Genome Browser
Species Human (GRCh38)
Location 7:151559907-151559929
Sequence GAGTGTGTGAAATGAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034514044_1034514048 -7 Left 1034514044 7:151559891-151559913 CCCACCTCTTACTACTGAGTGTG 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1034514048 7:151559907-151559929 GAGTGTGTGAAATGAGAGGAAGG No data
1034514045_1034514048 -8 Left 1034514045 7:151559892-151559914 CCACCTCTTACTACTGAGTGTGT 0: 1
1: 0
2: 1
3: 9
4: 153
Right 1034514048 7:151559907-151559929 GAGTGTGTGAAATGAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034514048 Original CRISPR GAGTGTGTGAAATGAGAGGA AGG Intronic
No off target data available for this crispr