ID: 1034516977

View in Genome Browser
Species Human (GRCh38)
Location 7:151588773-151588795
Sequence GACTCACAGTTCCACGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034516977_1034516980 17 Left 1034516977 7:151588773-151588795 CCAGTCACGTGGAACTGTGAGTC 0: 36
1: 862
2: 5111
3: 8006
4: 8083
Right 1034516980 7:151588813-151588835 TTTATAAATTACCCAGTCTCAGG 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034516977 Original CRISPR GACTCACAGTTCCACGTGAC TGG (reversed) Intronic
Too many off-targets to display for this crispr