ID: 1034520010

View in Genome Browser
Species Human (GRCh38)
Location 7:151612554-151612576
Sequence CTGTCCCATCAGCAGGCGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 90}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034520005_1034520010 -7 Left 1034520005 7:151612538-151612560 CCTGCTTCCACCTGTTCTGTCCC 0: 1
1: 0
2: 1
3: 39
4: 420
Right 1034520010 7:151612554-151612576 CTGTCCCATCAGCAGGCGTAGGG 0: 1
1: 0
2: 2
3: 16
4: 90
1034520002_1034520010 -4 Left 1034520002 7:151612535-151612557 CCCCCTGCTTCCACCTGTTCTGT 0: 1
1: 0
2: 4
3: 90
4: 532
Right 1034520010 7:151612554-151612576 CTGTCCCATCAGCAGGCGTAGGG 0: 1
1: 0
2: 2
3: 16
4: 90
1034520001_1034520010 5 Left 1034520001 7:151612526-151612548 CCTGGGGAACCCCCTGCTTCCAC 0: 1
1: 0
2: 2
3: 27
4: 281
Right 1034520010 7:151612554-151612576 CTGTCCCATCAGCAGGCGTAGGG 0: 1
1: 0
2: 2
3: 16
4: 90
1034519997_1034520010 29 Left 1034519997 7:151612502-151612524 CCACTGCTGCTCACTGTGAAGCA 0: 1
1: 0
2: 2
3: 32
4: 227
Right 1034520010 7:151612554-151612576 CTGTCCCATCAGCAGGCGTAGGG 0: 1
1: 0
2: 2
3: 16
4: 90
1034520003_1034520010 -5 Left 1034520003 7:151612536-151612558 CCCCTGCTTCCACCTGTTCTGTC 0: 1
1: 0
2: 3
3: 51
4: 474
Right 1034520010 7:151612554-151612576 CTGTCCCATCAGCAGGCGTAGGG 0: 1
1: 0
2: 2
3: 16
4: 90
1034520004_1034520010 -6 Left 1034520004 7:151612537-151612559 CCCTGCTTCCACCTGTTCTGTCC 0: 1
1: 0
2: 3
3: 36
4: 422
Right 1034520010 7:151612554-151612576 CTGTCCCATCAGCAGGCGTAGGG 0: 1
1: 0
2: 2
3: 16
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034520010 Original CRISPR CTGTCCCATCAGCAGGCGTA GGG Intronic
903377199 1:22874372-22874394 CTGTCCCACCAGGAGGCCAAAGG + Intronic
907697961 1:56753113-56753135 CAGTCCCATCTGCAGAAGTAGGG - Intronic
910863186 1:91763577-91763599 CTGTCCCCTCTTCAGGGGTAAGG + Intronic
914069659 1:144276195-144276217 CTGTACCAGCAGCTGGCGCAGGG - Intergenic
914109496 1:144690159-144690181 CTGTACCAGCAGCTGGCGCAGGG + Intergenic
920296250 1:204958936-204958958 CTCTGCCATCAGCAGGGATAGGG - Intronic
923936695 1:238768997-238769019 CTCAGCCATCAGCAGGGGTAAGG + Intergenic
1067343603 10:45422601-45422623 CTGTGCCCTCAGCATGCATAGGG + Intronic
1067686741 10:48470386-48470408 CTGTCCCATCAGCAGGGGTGGGG + Intronic
1068480203 10:57579904-57579926 CTGTACCATCAGCAGGAAAATGG - Intergenic
1075925432 10:126248052-126248074 CTGTGCCACCAGCAGGTGCAGGG - Intronic
1076754797 10:132563770-132563792 CTGTCTCACCAGCAAGCGCAAGG - Intronic
1077178667 11:1202738-1202760 CTGTCCCACCATCAGGCGTGGGG - Intergenic
1077720773 11:4626193-4626215 CTGTCCCATCAGCAGATAAATGG - Intergenic
1078879996 11:15438587-15438609 CTGTCCTATGAGCAGGGGTTGGG - Intergenic
1080725884 11:34899377-34899399 TTGTCCCATCAGCAGGAAAATGG + Intronic
1080916567 11:36666319-36666341 CTGTCCCAACAGCAGGAAAACGG + Intergenic
1082229036 11:49741953-49741975 CTGTCCCATCAGCAGGAAAATGG - Intergenic
1083901859 11:65647148-65647170 CTTTCCCTTCCGCAGGAGTAGGG - Intronic
1083945529 11:65920686-65920708 CTGTCCCATCACCAAGGGCAGGG - Intronic
1084019998 11:66411667-66411689 CTGCTCCATCAGCAGCCGTAAGG + Intergenic
1090292016 11:125553945-125553967 CTGTCCCTTCAGCAGGAAAATGG - Intergenic
1091784340 12:3233386-3233408 CTGTCCCATCCCCTGGCGGAGGG + Intronic
1092192829 12:6533262-6533284 TTGGCCCATCAGCAGGTGCATGG - Intergenic
1096579263 12:52573919-52573941 CTGGCCCATCAGCAGGGGAAAGG - Intergenic
1099958228 12:89371913-89371935 CTCTCCCATCAGGAGGGGAAAGG + Intergenic
1106362911 13:29049272-29049294 CTGTCCCATCATAAGGCATTGGG + Intronic
1117210918 14:53498838-53498860 CTGTCCCATACCCAGGAGTAAGG - Intergenic
1118615508 14:67572182-67572204 CTGTCCAGTGAGCAGGCGTCCGG - Exonic
1118912066 14:70069738-70069760 CTGTTCCATGAGAAGGCTTAGGG + Intronic
1121493628 14:94377562-94377584 CTGAGCCATCAGCAGGCCTATGG + Exonic
1122831028 14:104395958-104395980 CTGTCCCCTCAGCAGCCAAAGGG - Intergenic
1122905028 14:104797657-104797679 CAGTCCCAGCAGCAGCCGTGGGG - Intergenic
1128886195 15:71290207-71290229 CTGTGCCAGCACCAGGCCTAAGG - Intronic
1130036681 15:80367495-80367517 CTGTCTCATCAGCAGGAAAATGG + Intronic
1132558793 16:584251-584273 CCGTCCCATCAGCCGTCGTCAGG - Intergenic
1133890598 16:9875564-9875586 CTGTTCCATCAGCAGGCAAATGG + Intronic
1144808169 17:17981311-17981333 CTGTCCCGTCTGCAGGGATAGGG - Intronic
1147688566 17:42301337-42301359 CCCGCCCACCAGCAGGCGTACGG - Exonic
1148328158 17:46796048-46796070 CTGTCCCATCCGCAGGTGGTAGG + Intronic
1149300120 17:55297641-55297663 CTGTCCCCTGAGCAGCTGTAAGG + Intronic
1151479123 17:74360064-74360086 CAGTCCCAGCAGCAGGCGGTGGG + Exonic
1151935478 17:77258338-77258360 CTGTCCACTCAGCAGGCTGAGGG - Intergenic
1157661401 18:49448207-49448229 CTGTCTCATCAGCAGGAAAATGG + Intronic
1158016681 18:52791907-52791929 CTATCCCATCAGCAGGAAAATGG - Intronic
1158494168 18:57938510-57938532 CTGTCCCTCCACCAGGGGTATGG + Intergenic
1158836287 18:61334227-61334249 CTGTCCCCTCTGCAGGCGGAGGG - Intronic
1159174346 18:64814303-64814325 TTGTCCCATCAGCAGGAAAACGG + Intergenic
1161518533 19:4710611-4710633 CTGTCCCCTCAGCAGGCACCAGG - Intronic
925292280 2:2755869-2755891 CAGTCCCACCAGCAGGGGTAGGG - Intergenic
927151733 2:20200144-20200166 CTGCTCCATCAGCAGGTGCAGGG + Intergenic
929640323 2:43571679-43571701 ATTTCCCATCAGAAGGCATAGGG - Intronic
931538194 2:63301280-63301302 CTGTCCCATCAGCAGGAAAATGG + Intronic
942319796 2:174726275-174726297 CTGCCCCAGCAGCAGGAGTGAGG - Intergenic
947103486 2:226646006-226646028 CTTTACCACCAGTAGGCGTAGGG + Intergenic
947128668 2:226898239-226898261 TTGTCTTATTAGCAGGCGTAGGG + Intronic
1168958990 20:1855409-1855431 CTGACCCATCTGCAGGTGTCAGG + Intergenic
1169694833 20:8375700-8375722 CTTTGCCATTAACAGGCGTAAGG + Intronic
1184677445 22:46051385-46051407 CTGTCCCATGAGCAGGAGGGTGG + Exonic
949950116 3:9222007-9222029 CTGCCCCATCCACAGGAGTAGGG + Intronic
950181104 3:10914067-10914089 CTGTCCCACCAGCAGGGGTATGG - Intronic
952088824 3:29859388-29859410 CTTTACCATCAGCAGGAATAGGG - Intronic
953415374 3:42712609-42712631 CTTTCCCATCAGCAGCAGGAAGG - Intronic
954375376 3:50191704-50191726 TGGTCCCAGCAGCAGGCGAAGGG - Exonic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
956280928 3:67555944-67555966 ATGTCCCATCAGAAGGCACATGG - Intronic
958451725 3:94281334-94281356 CTGTCAGATGAGCAGGCATATGG - Intergenic
961375105 3:126459811-126459833 ATGTCCCAGAAGCAGGCTTATGG - Intronic
963990240 3:151644477-151644499 CTGTCCCATCCACAGATGTAGGG + Intergenic
966261534 3:177984652-177984674 CTGTCACAGCAGCAGGCTAACGG - Intergenic
968572525 4:1349550-1349572 CTGTGCTATCAGCAGGCGGTAGG - Exonic
970223390 4:13833020-13833042 CTGTCCTGTGAGCAGGCATAGGG - Intergenic
978019113 4:103786441-103786463 CTGTCCCATCAGCAGGAAAATGG + Intergenic
980642312 4:135596548-135596570 CTGTCCCATCAGCAGGAAAATGG + Intergenic
982919655 4:161256714-161256736 TTGTCCCATCAGCAGGAAAATGG - Intergenic
986134246 5:4959402-4959424 CTGTGCAATAAGCAGGAGTAAGG - Intergenic
995581431 5:113606868-113606890 CCGTCCCATCAGCAGGAAAATGG + Intergenic
996477403 5:123937161-123937183 CTGTCCCATCAGAAGGAAAATGG - Intergenic
1001041535 5:168339188-168339210 TTGTCCCCTCAGCAGGGGTAAGG + Intronic
1002180416 5:177428274-177428296 CAGTGCCATCAGCAGGCCTGAGG - Intronic
1002434310 5:179221641-179221663 CTGCCCCCTCAGGAGGCGCAGGG - Intronic
1002550140 5:179982282-179982304 ATGTCCCATCAACAGGTGAAAGG - Intronic
1002876806 6:1217863-1217885 CTGTCCCATCGGCAGGCTGTGGG + Intergenic
1003708387 6:8561118-8561140 CTGTCCCATCAGCATTCCTCAGG - Intergenic
1006152302 6:31996046-31996068 CTGTCCCAGCAGCAGGCTGACGG + Exonic
1006158605 6:32028784-32028806 CTGTCCCAGCAGCAGGCTGACGG + Exonic
1006340356 6:33443348-33443370 CTGGCCCATCAGCAGCCATGTGG - Exonic
1013643965 6:112117211-112117233 ATGTCCCATCATCTGGCATAGGG + Intronic
1015154405 6:130075517-130075539 CTGTCCCATCAGGTGTCGTGGGG + Intronic
1018910221 6:168097457-168097479 CTGTCCCGTCAGCGGGGCTAGGG - Intergenic
1020472698 7:8557155-8557177 CTGTCCCATAAGCACATGTATGG - Intronic
1023492983 7:40763971-40763993 CTGTTGCAACAGCAGGCCTAGGG + Intronic
1024620990 7:51157498-51157520 CTGTCCCATCAGCAGACCAGGGG - Intronic
1028351707 7:89857639-89857661 CTGTCCCATCAGCAGGAAAACGG + Intergenic
1033318484 7:140318105-140318127 CAGTGCCATCAACAGGCATATGG + Intronic
1034520010 7:151612554-151612576 CTGTCCCATCAGCAGGCGTAGGG + Intronic
1039649857 8:39329654-39329676 TTGTCCCATCAGCAGGAAAATGG - Intergenic
1040526064 8:48226294-48226316 CTGCCCCATCAGCAGGAAAATGG + Intergenic
1047749035 8:127866264-127866286 GGGTCCCATCAGCAGGAGTTGGG - Intergenic
1048052207 8:130828729-130828751 CTGTCCCATCAGTAGGTAAATGG + Intronic
1049356037 8:142188712-142188734 GTGTCCCATGTGCAGGCGTGTGG - Intergenic
1049623670 8:143610622-143610644 CTGTCCCATCTGCTGCCGTGGGG - Intergenic
1051991961 9:23162648-23162670 CTGTCCCAGCAGCAGCCATTCGG + Intergenic
1053296041 9:36913507-36913529 CTCCCCCATCAGCAGGCCTGTGG + Intronic
1056848046 9:90057471-90057493 CTGTCCCATCAGCAGTCTGCTGG - Intergenic
1056879833 9:90380529-90380551 CTGTCCCATCAGCTGGGGGTGGG - Intergenic
1185718885 X:2366111-2366133 CTCTGCCATCAGCCGTCGTAGGG - Intronic
1193790807 X:85813405-85813427 CTGTCCCATCAGCAGGAAAATGG + Intergenic
1200427925 Y:3042017-3042039 TTGGCCCATCAGCAGTCATATGG + Intergenic