ID: 1034522507

View in Genome Browser
Species Human (GRCh38)
Location 7:151631949-151631971
Sequence GCAGGACGCAGCTCGCCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034522496_1034522507 -1 Left 1034522496 7:151631927-151631949 CCGCCCCGGCCCCTGGGCTTCCG 0: 1
1: 0
2: 0
3: 38
4: 472
Right 1034522507 7:151631949-151631971 GCAGGACGCAGCTCGCCGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1034522486_1034522507 13 Left 1034522486 7:151631913-151631935 CCCCGCCCCGGTTCCCGCCCCGG 0: 1
1: 0
2: 9
3: 132
4: 915
Right 1034522507 7:151631949-151631971 GCAGGACGCAGCTCGCCGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1034522497_1034522507 -4 Left 1034522497 7:151631930-151631952 CCCCGGCCCCTGGGCTTCCGCAG 0: 1
1: 2
2: 1
3: 27
4: 327
Right 1034522507 7:151631949-151631971 GCAGGACGCAGCTCGCCGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1034522489_1034522507 11 Left 1034522489 7:151631915-151631937 CCGCCCCGGTTCCCGCCCCGGCC 0: 1
1: 1
2: 6
3: 111
4: 1016
Right 1034522507 7:151631949-151631971 GCAGGACGCAGCTCGCCGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1034522484_1034522507 20 Left 1034522484 7:151631906-151631928 CCCGCATCCCCGCCCCGGTTCCC 0: 1
1: 0
2: 3
3: 40
4: 427
Right 1034522507 7:151631949-151631971 GCAGGACGCAGCTCGCCGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1034522490_1034522507 8 Left 1034522490 7:151631918-151631940 CCCCGGTTCCCGCCCCGGCCCCT 0: 1
1: 0
2: 14
3: 243
4: 1264
Right 1034522507 7:151631949-151631971 GCAGGACGCAGCTCGCCGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1034522488_1034522507 12 Left 1034522488 7:151631914-151631936 CCCGCCCCGGTTCCCGCCCCGGC 0: 1
1: 2
2: 15
3: 275
4: 1187
Right 1034522507 7:151631949-151631971 GCAGGACGCAGCTCGCCGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1034522501_1034522507 -10 Left 1034522501 7:151631936-151631958 CCCCTGGGCTTCCGCAGGACGCA 0: 1
1: 0
2: 1
3: 11
4: 122
Right 1034522507 7:151631949-151631971 GCAGGACGCAGCTCGCCGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1034522485_1034522507 19 Left 1034522485 7:151631907-151631929 CCGCATCCCCGCCCCGGTTCCCG 0: 1
1: 0
2: 1
3: 55
4: 429
Right 1034522507 7:151631949-151631971 GCAGGACGCAGCTCGCCGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1034522491_1034522507 7 Left 1034522491 7:151631919-151631941 CCCGGTTCCCGCCCCGGCCCCTG 0: 1
1: 0
2: 7
3: 124
4: 976
Right 1034522507 7:151631949-151631971 GCAGGACGCAGCTCGCCGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1034522495_1034522507 0 Left 1034522495 7:151631926-151631948 CCCGCCCCGGCCCCTGGGCTTCC 0: 1
1: 0
2: 8
3: 115
4: 912
Right 1034522507 7:151631949-151631971 GCAGGACGCAGCTCGCCGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1034522500_1034522507 -6 Left 1034522500 7:151631932-151631954 CCGGCCCCTGGGCTTCCGCAGGA 0: 1
1: 0
2: 1
3: 32
4: 282
Right 1034522507 7:151631949-151631971 GCAGGACGCAGCTCGCCGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1034522498_1034522507 -5 Left 1034522498 7:151631931-151631953 CCCGGCCCCTGGGCTTCCGCAGG 0: 1
1: 0
2: 3
3: 33
4: 420
Right 1034522507 7:151631949-151631971 GCAGGACGCAGCTCGCCGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1034522492_1034522507 6 Left 1034522492 7:151631920-151631942 CCGGTTCCCGCCCCGGCCCCTGG 0: 1
1: 0
2: 4
3: 95
4: 686
Right 1034522507 7:151631949-151631971 GCAGGACGCAGCTCGCCGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1034522482_1034522507 26 Left 1034522482 7:151631900-151631922 CCGGCGCCCGCATCCCCGCCCCG 0: 1
1: 1
2: 8
3: 120
4: 940
Right 1034522507 7:151631949-151631971 GCAGGACGCAGCTCGCCGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034522507 Original CRISPR GCAGGACGCAGCTCGCCGTG GGG Intronic