ID: 1034522533

View in Genome Browser
Species Human (GRCh38)
Location 7:151632020-151632042
Sequence CGGCCGGGCCGTGGGAGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 282}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034522521_1034522533 0 Left 1034522521 7:151631997-151632019 CCCCGCGGGTCCCGGTCCTCGGG 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1034522533 7:151632020-151632042 CGGCCGGGCCGTGGGAGCGCCGG 0: 1
1: 0
2: 2
3: 24
4: 282
1034522524_1034522533 -2 Left 1034522524 7:151631999-151632021 CCGCGGGTCCCGGTCCTCGGGCG 0: 1
1: 0
2: 0
3: 15
4: 83
Right 1034522533 7:151632020-151632042 CGGCCGGGCCGTGGGAGCGCCGG 0: 1
1: 0
2: 2
3: 24
4: 282
1034522523_1034522533 -1 Left 1034522523 7:151631998-151632020 CCCGCGGGTCCCGGTCCTCGGGC 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1034522533 7:151632020-151632042 CGGCCGGGCCGTGGGAGCGCCGG 0: 1
1: 0
2: 2
3: 24
4: 282
1034522528_1034522533 -10 Left 1034522528 7:151632007-151632029 CCCGGTCCTCGGGCGGCCGGGCC 0: 1
1: 0
2: 2
3: 18
4: 368
Right 1034522533 7:151632020-151632042 CGGCCGGGCCGTGGGAGCGCCGG 0: 1
1: 0
2: 2
3: 24
4: 282
1034522516_1034522533 20 Left 1034522516 7:151631977-151631999 CCGGAGATGGGGCGCGGGGTCCC 0: 1
1: 0
2: 2
3: 9
4: 134
Right 1034522533 7:151632020-151632042 CGGCCGGGCCGTGGGAGCGCCGG 0: 1
1: 0
2: 2
3: 24
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034522533 Original CRISPR CGGCCGGGCCGTGGGAGCGC CGG Intronic